Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

rwhdp20n23
Contig Information
Length 592 bp
Tissue Seed DPA20
Clones 1 Clones [Download: CSV  ,  FASTA ]
rwhdp20n23   
Homology (BLAST) Top Hit putative small basic membrane integral protein [Oryza sativa Japonica Group]
Score 550
Evalue 8.76198e-55
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>rwhdp20n23
TCGATGTAATGTTGAGGGGATTAAATACAGGCCTTCCAAATTATTCCCTAGCAAACCATGTTCCCTTCTTCAGGTCCCCCAATTGCTAAGTCAAAGTTTG
TGCTTGAGTTCATCATGCTTTCTTGGTCTTGGGCTTAGGGGCCGGTGGCGGGAACACGGCCCTGAAGGTCCACGCAGCGAGAATGGCACCGATGAAGGGG
CATATCCAGTACACGTACAGCTGCTCCCAGGTGTTGTGCAGATTGTTAACATACGCCCAACCAAAGGCGTTGGCAGGGTTCATGGAGGGGCCGGTGTACG
CGGCGCCGGTGAGGACGAGGCTGACGGTGGAGACTGAGAGCATCGCTGTCTTGACGATGGGGTTGCGGGGTCCCTTGACGATGATGCANAGGACGGCAAA
GGTGATGACGAAGGTGAGCACCCCTTCANCGACGGCGCCGGTGTGGGGATCCACCTTGANCGANGGTCCGCCNANCATGTGCTTGTACTGCTCCNNCATC
ANCTCNNANATGNCCANANCTCCNCCCACNNNTCCNNCNNNCTGCNCTNNNANNCNNANCNCNATNNANAATANNNANNNNNTNNNNANNCC
page-top