Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whdp9p17
Contig Information
Length 539 bp
Tissue Seed DPA20
Clones 1 Clones [Download: CSV  ,  FASTA ]
whdp9p17   
Homology (BLAST) Top Hit hypothetical protein OsI_19936 [Oryza sativa Indica Group]
Score 753
Evalue 1.9626e-78
Total Hit Count 39
Registered year 2003
Contig Sequence     [ Download ]
>whdp9p17
CTGTATTTATTGCAATGCCNCAACATATGTGGGACAAGTTAGCAGAAGATACAGCAAATCTTGTCAGAAACTTGGTAAATGCTCCGAGCAGTCTTCTATT
GGGTAAAGGGGCCTTTTTTGTTCATGCCAATAACACAATATTTCAAGTATTGAAAGATGGAGCAACATTGATGAGTACCAGATTAGAGGTACAAGCCCCC
AGGATCCATTGTGTTCATCCAACATGGTTTGAAGCAGGAAAGCCTATTGAACTACTCCTTTGTGGAAGTTCTCTTGATCAGCCTAAATTCAGATCACTTC
TATCATTTGATGGAGAGTACTTGAAGCATGATTGTTGCCGTCTAACGTCTCGTGGAACCTTTGGTTGCGTGAAAAATGGTGCTCCTACATTTGATTCTCA
CCACGAAGTTTTCCGGATAAACATCACTCAAACCAAGCCGGATACTCATGGACCTGGTTTTGTGGAAGTGGAAAATGTGTTTGGGCTATCAAATTTTGTC
CCTATCCTTTTCGGTAGCAAACAGTTGTGTTTTGAACTA
page-top