Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

rwhdp9b06
Contig Information
Length 676 bp
Tissue Seed DPA20
Clones 1 Clones [Download: CSV  ,  FASTA ]
rwhdp9b06   
Homology (BLAST) Top Hit alanine aminotransferase 2 [Zea mays]
Score 467
Evalue 5.03316e-45
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>rwhdp9b06
TTATTTATTGGTAGTACAACACAGGGCTTAATTTACAGGGTAGTGAAAGTTTATTTATTGGCAGTACAACACAGGTTTAATTTACAAGGTAGTGAAGATC
ACACCTTCGGAGCTCTGACCGGCCTGTGGCTTGTGTAGGTGAAAGTGCGCATCAGCTTCGGTTGCGGAACTCGTTCATGAAGGACTCGTGGAACTCCTTG
AGGCGCGGGATCATCGCCTTGATCTTGTCCTCGCCGGGGAGGATCGTGCACCGGATATGCCATGTCCCGGTGGCCTTGTTGCGCCCAGACACCTGGTGGA
ATCCAGAGCCAGGGACAACGGCGATCCCGGTGGCGTTGAGAAGGCGGCACGCGTAGAACATGTCTGGAGACATGCCCTCGGCCTTGGCGGCTTTGATCGC
CGCTGCAGGGAGGTGGATCCGTGGGAAGGCGTANATTGCACCTTCTACTTTGTTGCAGGTCATTCCCTCCANGCTGCTGAATGCNCTCGCCAAGGTCTTG
GCGCGCTTGGCGANAGATAAACNGATGTCTTCCTTTTCANCCATAAAATCCTCAAAACAACCATCTCCCANCTTCNGTGGATCCATANCAAGGCTANTAN
NAATTTNACCACTTNTGTTNNGNCAANNANTCNCANAANCCACTTTNCNAATCTCNCCCNTCANATCNTCTCCNNA
page-top