Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

rwhdp20o02
Contig Information
Length 581 bp
Tissue Seed DPA20
Clones 1 Clones [Download: CSV  ,  FASTA ]
rwhdp20o02   
Homology (BLAST) Top Hit unknown [Zea mays]
Score 290
Evalue 1.16249e-24
Total Hit Count 13
Registered year 2003
Contig Sequence     [ Download ]
>rwhdp20o02
AAGCCCCTTTGTCGCCTCTAGCAAACCTACAGCCACTGCTGGCAACATCCAANAAAGAACTANATCAAGTAAGATGATGGCGCTGCAGAAAAGAGTTAAT
CCCACGACAAAAGAAAGCCCTACGACGACACGACGACGATATGGACAGGAAAGCCATTCGCTTTCCCTACTGTTGTTTTAGTTCCTTCCATCCGAAGTTA
CAAAAACTAAATATGGTACAGGGAGAGAGAGCAAGAAAAGCATGCACTATTTGCCCGCCTAATGCTACTACTGGTGCTGCTGCTGCTACCTGTTTCCTAT
GTCTTTCCAGGGGTGGTCGGCGTCCTTGCCCAGGAACTTCGAGCTCGAGCCGTACTGCGCCTTGAGGGCCGCCACCGGGTCCGACACGGGGCTCACAAGG
ATCCCGGCGCCACCGAGCCGCGCGGNTTTCCCGGGCTGCTGCTGCTGGAACCCTGAGATGAGCTCTATTCCGTTCCTCTTCTGGAGATCACCGTANCTTT
CCAGCCGCTTCGGATCTGATGGAANCTGCTGCCGCAAANGCTGCTGGTACTCTGCTAATACACCCAATGTGCCATTTTTAG
page-top