Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

rwhdp20p02
Contig Information
Length 718 bp
Tissue Seed DPA20
Clones 1 Clones [Download: CSV  ,  FASTA ]
rwhdp20p02   
Homology (BLAST) Top Hit hypothetical protein OsI_31300 [Oryza sativa Indica Group]
Score 694
Evalue 2.71241e-71
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>rwhdp20p02
GAGTTGAGTCCATAGGAGTACAACATAGGAGTAACATGATAGCTCAGTGTTTAAGAGAGCCATGCTGCGCAATTTTTCTCTCAAGGCCGGTCTTGTCAGC
CCCGACAACCTTATCAATCTCTTTGCCGTTTATCACACAGGAGAATGTTGGAACACTTGAGACATTCCAGCGATGGGCAATATTGCCTTGTTGATCAATG
TCCAGCTTAAGGAATACGACATTCCGGTGCTGTTCAGATAAGCTTTTGTAAACAGGGCCCATAAAACGACATGGTCCACACCATGTTGCAGTAAAATACA
GAATCACAAGCTTTGACAGTTTTGACGCGGCTGTAAATATTTCTTCCAGTTGATTAGATGAGTGGATAGTGATCACATCACCAGGCTTTAGAACAGCAGA
AGCAGCAGAAACCTCCTCAGCATGCCTACGTTGTCTTTCCAAGTCAGCTTTTTTCATGTCCCTCTCTTTACGCAGGCGTTCATACTTTTTCTTGTGCTCC
TCAATTTTGTGTACATTGGGTTCAACCTTCTTAAGCTCTGAGCTGATCTCTTCATCAAAATCCAAATTTTGCTGCCAAGTGAAGGTCATGAGCAGCATCT
TCCCACTTCCCAAGCATAGCTTTCGCCATCCCTCGTGATTTATATCCTTTAGCAGAATCTGGATTTATCTGTAATGCTGCCTCCGCATCAAGAATTGCTG
CATTTGGTTTCTTCATCT
page-top