Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

rwhdp20o05
Contig Information
Length 726 bp
Tissue Seed DPA20
Clones 1 Clones [Download: CSV  ,  FASTA ]
rwhdp20o05   
Homology (BLAST) Top Hit hypothetical protein OsI_25587 [Oryza sativa Indica Group]
Score 563
Evalue 4.28196e-56
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>rwhdp20o05
AAGCCCGAAAGAGTTTGGCATATGCCAAAAGTACGCGCTTACAAATGGAGCAAAGTTTGAATCTGGAATTCACATCCATAAGCCTTCTAGCGATCAAGTG
TCAACTGCTACTACTACCCGAACACGACCATCCTAACCACGGACACTATACCATCCAAAAAATTGCTCCCAGCCAAACCTGTTGTCACCTATCCAATATC
AGGTTTCTTCACTCACAAAAAGTCAACCCTGCTGCACAACGATCTGACTAAAAGCCCACGTCAACAGAAGAACATCGAACTGCACACATCAGCATGCAGC
CGTGGCAGTTCCGGGACTGTTGCTGCTGTTGACGACGAAGGGACACCACTCCCAGATGAGGTATCAGCAAACTCCTCGAATTTTATGAACTGGCTCATCT
GCGCTGCTGCAAGGTGGGCGTAACAGATAGGTGCCACCACAGATATTGCAGTGGTGCTCCTCTGGTACACATAGGAAAGGGAAAGAACTAGGCTCTGGAG
TTCATCTGCTGTGAAACCAATCTGATCAAGCAAGACATGATAATGGGTGGGCCTTGAGGTGCCTATAGGTCCCGCATGAGCACACATGTAGAAATCATAC
TGTTTCGGATGAACAATACCCGAGTCCACTACAGTCCCAGCTGGAACATTATCTGGTGCGTCAGCTTGGAACAGTTTCGTGTGGTGATTCTTTTGAGCAA
TAATAACTGTAATCTTTGGAGGTGGC
page-top