Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

rwhdp20o17
Contig Information
Length 733 bp
Tissue Seed DPA20
Clones 1 Clones [Download: CSV  ,  FASTA ]
rwhdp20o17   
Homology (BLAST) Top Hit hypothetical protein OsI_36120 [Oryza sativa Indica Group]
Score 803
Evalue 6.51235e-84
Total Hit Count 279
Registered year 2003
Contig Sequence     [ Download ]
>rwhdp20o17
ACATACGCACGNTTTACATGCACAGGGACTACATGCAAATTCTTCCTCTTTTATTCTGCCACCCTTGTTTTATTGCAATCCGATGCCTACGAAGGCTCTA
TACTACTATTACAAGAACATGATCCGGGGGGCCACGAAGCACTGTCATGTTACACACCCAATAGAGATTCCCTGGCATGTTCGTTTCTTGCACATTTGTC
AGATCTCACTGAAGGAACTGATAGTCCGGAAGCCATGATTCGCAGGAAGCGGTGCGTTCCCCGGGCGAATGGAGATTATTACCTCGAAACCTGCACTCTT
TGCGGCAACGGCTTCTTGCAACACATCTGTGATGAATAAGATTTGAGACGGATTGTCCACCCCAAGTGATTGCGAGATCTCAAAATAACTCCTTGCTTCT
CTTTTGTTTCCGGTTGTGGTGTCGAAAAAACCACACAGAAATTGCCGCAGATCACCATAAGATGTATGTCCAAATAGTAGCTTCTGTGCCTCTCTACTGC
CACTTGAGTATATGTAAACCTTCATACCCTGAGATTGCCAGTTCTTCAGTGCCTCGGGAACATCCTCAAAAACAACTCCTTTCAGTTCTTTCCTTTCAAA
CCCAGTCCTCCATATATGTCCCTGAAGTTGTTTCAATGATGTAATCTTCCGGTCTGCTTTGATCATTGCTTCAACATTANCGACTAAAGAACTGATAACC
TCTTCTTTGCCAGCATCATCCGGNGCAACTGGA
page-top