Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whdp10a13
Contig Information
Length 679 bp
Tissue Seed DPA20
Clones 1 Clones [Download: CSV  ,  FASTA ]
whdp10a13   
Homology (BLAST) Top Hit Os03g0387900 [Oryza sativa (japonica cultivar-group)] >gi|108708529|gb|ABF96324.1| expressed protein [Oryza sativa (japonica cultivar-group)] >gi|108708532|gb|ABF96327.1| expressed protein [Oryza sativa (japonica cultivar-group)] >gi|113548733|dbj|BAF12176.1| Os03g0387900 [Oryza sativa (japonica cultivar-group)] >gi|215713510|dbj|BAG94647.1| unnamed protein product [Oryza sativa Japonica Group]
Score 545
Evalue 4.54176e-54
Total Hit Count 20
Registered year 2003
Contig Sequence     [ Download ]
>whdp10a13
AATCCCTACCAACAGCTGACGAGCAATTCAATGACAATTATCCATTCAACGAGCAAAAGAATGTTAATGTATATGGAGAACAGTCTTACCATGGGGGCGC
AATGGAATTGTTGTCCACTGACCAGATATGCAATGGAGATGGAAACATTGATATGATTGGCGAGCGATATTCATCAGAAAATGCCTTGCAACAGTTGGAG
GGCAGGAAGTTTTCTGTATCTTCAGGATCTCAATTAAGCTCCTCCCAGAATTTACTGAAGCAAAAGCACCACTCAGATAAAACTTCACCAAGTAATATTA
CTTCTGATTGCTATTCAGATAGAAACTGCCAGTTCAGTCCATCTATATCTTTTGCACAGAGGAACTTGATGGTTCAAAAACAAGTGGCTAATTTGCAACC
AGGACAGCTCATAAATGATGAAGGACAACTTGGTCAACAAACATTGACTAGAAGAGCTTCATATCCTTGTGAGAACTATGAGGTTGAAAAGAAGGGCTTT
GGAAAACAAAGTAAGGATACACTGGGTACATCAGTAGTGGTGGATGGCTCTTTTGTGTCGTCTCTTTCTTCTGATAATTCTGTTGAAGAAAGCAGCTTCC
AACAACTTCAGGATGCAGTTAGTCAGTTGGACGTGAAAACCAAACTGTGCATTANAGATGGTTTGTACCGCCTGGCAAG
page-top