Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

rwhdp20p10
Contig Information
Length 730 bp
Tissue Seed DPA20
Clones 1 Clones [Download: CSV  ,  FASTA ]
rwhdp20p10   
Homology (BLAST) Top Hit hypothetical protein PFL_1926 [Pseudomonas fluorescens Pf-5] >gi|68343607|gb|AAY91213.1| conserved hypothetical protein [Pseudomonas fluorescens Pf-5]
Score 82
Evalue 2.5978
Total Hit Count 1
Registered year 2003
Contig Sequence     [ Download ]
>rwhdp20p10
CAGCATTCAAAACAGTAGTTTATTGTTGCCTTAATTCAAAGATTTGTGAACATCATTACTTATAATATCATCACTGAGTATCCCTTTAGACCCTTATAAA
TTTGGCCTAGAACCACCACAAGGGTACTAAGCCAAGCAGCAGCAGCAACAACAACATCGGCTCTTATAATATAAACACTCTCGATCGACTGACTTTCATC
TCATAGTGTCATTTGTTGATTATTATAAACGACTGGAGCGAGCTTCGCTTCCCGAGCCCGGTCGATGGCTTGCTTGATGATCTTTGGTCTTCTTTTCACG
CTCCTTGCCTGCATTCGGATTTGATGCCTGCATCGAGTATCCACGTGATTGCACGAATGATTCGGGCGGATAATTGCCGCCATAACTTGAAGATGGATAC
TGCTGGCTTGGTCCTCCTCCTCCAGCCGCATAACTTGGCGGAGCTGAGAATTGATTGCCACCAAATGGATACGTTTGTGCCGTGTGCTGCGACATTGATT
TGTAAGTGTTGTAGCACATGGTTAAAATACTGATAATTGTCGACACAGTTCCAATGACCTCGCCAATGCTAATATCTATACTAGGTCCAGGCGGCGGCGG
CCTAACCTTGCGACGTTGAATGGAAGGCTCATCTGGGATGGTTGGGTAACGAATATCGCCGCCGCCACCGCCCGGANGAAGTGATGGATAGGCAGGATAT
GGGGGATATGAAGGGAAATTGCCCCCAGGG
page-top