Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whfl_all.Contig52
Contig Information
Length 577 bp
Tissue Spikelet (at early flowering) full length cDNA
Clones 2 Clones [Download: CSV  ,  FASTA ]
whfl20f07    whfl47d10   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os07g0152900 [Oryza sativa (japonica cultivar-group)] >gi|34395056|dbj|BAC84719.1| putative glycolate oxidase [Oryza sativa Japonica Group] >gi|50508805|dbj|BAD31578.1| putative (S)-2-hydroxy-acid oxidase [Oryza sativa Japonica Group] >gi|113610445|dbj|BAF20823.1| Os07g0152900 [Oryza sativa (japonica cultivar-group)] >gi|215678898|dbj|BAG96328.1| unnamed protein product [Oryza sativa Japonica Group] >gi|215692798|dbj|BAG88242.1| unnamed protein product [Oryza sativa Japonica Group] >gi|218199102|gb|EEC81529.1| hypothetical protein OsI_24928 [Oryza sativa Indica Group]
Score 774
Evalue 8.79803e-81
Total Hit Count 500
Registered year
Contig Sequence     [ Download ]
>whfl_all.Contig52
ctcgttccttccttcccttcccctcagccttgaggggacagtcagccacagcctcctcatacaagaaaaatggagatcaccaatgtcacagagtaccagg
ccatcgccaagcagaagcttcccaagatgatctatGACTACTATGCCTCcggtgcCGAGGACGAGTGGACGCTCCAGGAGAACAGGGAGGCCTTTGCCAG
GATCCTGTTCCGCCCGCGCATTCTGATCGATGTATCCAAAATCGACATGACAACAACTATCCTGGGATTCAAGCTCTCAATGCCCATCATGATTTCCCCC
ACTGCCATGCAgaagatGGCTCACCCAGATGGAGAGTATGCGACTGCCCGCGCAgcatcagcagcaggcactataatgacattgtcgtcctgggctactt
caagtgttgaggaggttgcctcaaccggaccagggatccgtttcttccaactctatgtctacaaagacaggaaggtggtcgagcagcttgtgaggagagc
ggaaaaggctggattcaaggcgatagcgctcaccgtggacaccccgcgacttggccgcagggaagctgatatcaaga
page-top