Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whcs5i06
Contig Information
Length 677 bp
Tissue Callus
Clones 1 Clones [Download: CSV  ,  FASTA ]
whcs5i06   
Homology (BLAST) Top Hit expressed protein [Oryza sativa (japonica cultivar-group)]
Score 777
Evalue 5.69229e-81
Total Hit Count 17
Registered year 2003
Contig Sequence     [ Download ]
>whcs5i06
ACGATGGGCTCTCTGTCGGACTCGCAGGCGAATGGCGACCGTCAGCCGCCGCCGGCGGAGGCGGAGGATGCCGGGCCGCAGGTCNAGGAGGGAGATACCG
GCGAGAAGATGGAGGGCGTCGCATCCATCGCGCTGCTGCCCTCTGGCGCCATCTCCGGCCACTTCATCCGCCTCCCGGACTCCGCCTGCTACGGCCTCCA
GGGCACCCCGATACCATGCNAGAGGGAATGTANCCGAGGAGATGATTACCGCCTTATAAAGCTATCCATCATTAATTTTAAGAGGAAGACAGAGAAGGTG
GTTGTGGTGGAATGCAGGGGACATGATGCTGCTCGATTACAAAACATTGACCATTTGCATGGATGGGAAGATGACGTTGTTGGACTGGTTCAAAAGAAAC
ATGGGAATAAGAAAGTCTTGGTCTCTTTCGAATGCGAGACGCTGAAGGCTGATAAAGCCGCTGAAGAACATATTANCAAGTATATGCCAAATCTTTGCNG
ACTGGACGCANTTGTAAACACGGGGAAGATGAGTATCTCCGGCATCAACCTAGACGAGGACGATGAACCAAGCGGCGACAGCTGANAGCANAAACACGTT
GTCAATGTGTTAGCTGCGACGGTTTCTCTGCCTCGTCGATGCCGTCGACAAAGCAGGACTGTGTGTCGCTGTTACCC
page-top