Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

rwhcs10a15
Contig Information
Length 275 bp
Tissue Callus
Clones 1 Clones [Download: CSV  ,  FASTA ]
rwhcs10a15   
Homology (BLAST) Top Hit gamma-SNAP [Hordeum vulgare subsp. vulgare]
Score 387
Evalue 3.97211e-36
Total Hit Count 80
Registered year 2003
Contig Sequence     [ Download ]
>rwhcs10a15
GAATGCAGCGGCATCCGAGTACTTCTCAAGCTTCACATATAAACTTGCAGCAGCACGGTACAAGTCAAAAGCCATCTGCTCCTTTCCATCTTCTTCTANA
AGTGTGCAAGCGTCATCATACAATTTANTTGCTTCTTCTGGAGCTTTATCTTCCAAGGCACTGGCACCCTTTGCAAGAGCATCANAGGCAGGTTGTGATC
TTCCACATTCNCGGNAAAATTCTGATGCTCTGCNATAAAAGTCGGAAACTTCATTCCNNANTCCNAGCTCCTTTG
page-top