Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

rwhcs10a20
Contig Information
Length 660 bp
Tissue Callus
Clones 1 Clones [Download: CSV  ,  FASTA ]
rwhcs10a20   
Homology (BLAST) Top Hit hypothetical protein OsI_16154 [Oryza sativa Indica Group]
Score 682
Evalue 5.53137e-70
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>rwhcs10a20
TTTTAGCACCGATAGCCGCTCTGGCCTCACGGCATAACAGTACCCAGCCCCACGAATCGCGCCACCTCCAAATCCAGAGTGAACACATCTAGTACGATCC
ATTAACCAATGGTAGCACTACTACTACCGTAGCAGCCATAGTCCAGCCTAGCTAGAAGGAGAACGTGAAGCGCATGTCGTGTTTGTACACCTGGCCGGGC
CTCACCGTCACCGACGGGAACTCGGGGTGGTTCACGGCGTCCGGGTACGCCTGCGTCTCGAGGCAGAACCCGCCGTACTGCTCGTACAGCTTGCCGCCCT
TCCCCTGGGTGTGGTTCAGAAAGTTGCCGGTGTAGAGCTGCATGGCCGGCTGGTTGGCCCACAGCTCCAGCGCGCGCCCGGACTTGCCGTCCCGCGCCAC
CGCCACCTTCCGCATGCCCTCCCCGTCGATGACGTAGTTGATGTCGTACCCGTAGACTTTGCCGCCCATGACCTGCCTGATGCGCGCGCCGATTGGCATC
GGCGTGCGGAAGTCGTANCTGGTGCCATCCACGGGGTCNACNCGGCCGGACTACNGGAGCATCTCCCCGTCCANCGGGGTGTAGCGGGACGCNNATAGCT
GGANCGTGTGGCCCANGATGTCNCNGNTGNCCTNNCCNNCNANGTTNNGTANNNNTNCTG
page-top