Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

rwhcs10c03
Contig Information
Length 894 bp
Tissue Callus
Clones 1 Clones [Download: CSV  ,  FASTA ]
rwhcs10c03   
Homology (BLAST) Top Hit hypothetical protein HCH_04402 [Hahella chejuensis KCTC 2396] >gi|83635140|gb|ABC31107.1| conserved hypothetical protein [Hahella chejuensis KCTC 2396]
Score 80
Evalue 6.35821
Total Hit Count 1
Registered year 2003
Contig Sequence     [ Download ]
>rwhcs10c03
CTTGGCACCNTCCAGAAAACACAAATCACATAAAAGGACCCCTATTCGCTGCTCTAAAATAGTTCAAACACTAAATGGTCCAAACAATTGAGTAATATCC
ATGACCACAAGATTTCTACTCCAGAACACTTGAGCACCAGTCCAGAACACACATAAGATTCATGATTACAATTAAGTTGGCTGGTCCTGAGCCTGCACGC
CCTCTCTTTTACTATCTTGCATCTTGCATCTTCCTTTTTTCCTTTCTCCAGAGAAAACNTCATTCTACACACAACTTCCTTCCTGATCTTCTTCTCCCTA
GCATCGGATCGCCAATCAACCAAGCACCTGCNGCTNCGCGGTGCATGCTCATGTCCAAGTCTCCCACTCCATCCGCCACCACGCCCATGCCCAGCTGCTG
ATAGGCCCTGTAATCATTTGCTCCACCCCTGCCACTCTAATGTTCGAGCTCCTCCTATACCCACTTCTCNTATTCTTCCGAGTGATTTGAACCTGCAGAA
GTTAGCATATACTTTCAAGATAAAACTAATACTCAGCTATGTTACATGAAGATGCCATTCAATCTACATGACTGTTAAATGCATATCTCCTAGCAGTCCA
CATTCTACATGTGTAATGTGTTAAAAGCACCTCGAGATTTTCTTATTGTTTCAGATAGCACTACGTGCTCAACATCACACATTAAATGGTTGGAGAATCA
TGACAATTCTTCTTTGGGCTGGTCCTTAAGTTTAGAGAATAGAAGATCTACTACCAAATTAGCCTAAAACAACACAATTCTAGGTCCAACGCCTTGGCAT
ATACAGCCAGATATGATGTTTGTTCCTTAAACTATGCATGCAANGTGTGCAATATCTCATGTCTAAGGNAATGAATGAAATTTCTGACTTCCTA
page-top