Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

rwhcs10c19
Contig Information
Length 906 bp
Tissue Callus
Clones 1 Clones [Download: CSV  ,  FASTA ]
rwhcs10c19   
Homology (BLAST) Top Hit pyruvate kinase [Capsicum annuum]
Score 211
Evalue 4.20286e-15
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>rwhcs10c19
GTCTAGATCATCTGAAATGGCCATGAAATTACAAAGTGGGAAGGTGGAACAACATTTACACAAGTATAGCATGCAAAATCAGCAACTTATGTGTATAGTC
TACAGCTTCATCAGGGCAAGTAAAAAAAAATCAGTCCGGCCTATAAATTGTACATAAAAAACTGCAGTTAAACCAATGGACAATTGGAATGGATGTTGCC
TACAATCGCTGTGACAACAGGCTCACCAGCAAGGTTGCACTTGTAGATCATCATTTTCTGTGCAAGGGATATCTTCTCAACTGAAATCTCCATTCCAAAA
TCACCTCTGGCCATGAAGTAATTGGTTTCCCACAAAGTGTCATCAAAGTTTACAATGCCCTCTTGGTTTCAACCTACCAATTCAAGAAAGAATAACAACA
TAGCCGACATGGTCACGGGCAAGCACGTATGTTTATAGGCACAGTAGATTTAGTCAACACAGCAGTTGAACGAAGCTAAGTAATCTGAACAATTTTACAA
GTACCAAGAAATAAAACTTACCACAGGAGATGCAAGAAATAAAATTAGGCAAAACTTGTTCAACAAATTATGCTAAGGCTTTTGTGAACCAAGTGTATTC
ATTAAGGAAAGCACATAGAAGAGAACCAATTATGTATTTTTTGACTATATAACACATAATAGACTATAATGTTTTTTTACAAACAGGAGTAGATGTGAAA
CATGTCCTCGGAGAGACAAAGAGTTCATGGGTTCCAGAATCAAGTGTGTATATTAACAAAAAGTTGGACGTTATAACAGTAAGTTGTCGAGTGTGTATAT
TAACAAAAAGTTGGACGACATAACAGTAAGGCAACTCAATGAAAGGAAGGAACATCATCTGTGGTTGCCCCTGGTACTTAACTGACGTGCAAAAACATTT
CATCAG
page-top