Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

rwhcs10d13
Contig Information
Length 785 bp
Tissue Callus
Clones 1 Clones [Download: CSV  ,  FASTA ]
rwhcs10d13   
Homology (BLAST) Top Hit hypothetical protein OsJ_000504 [Oryza sativa (japonica cultivar-group)]
Score 80
Evalue 5.07982
Total Hit Count 2
Registered year 2003
Contig Sequence     [ Download ]
>rwhcs10d13
TATAATTGTTAGCTAAAGTTCTCTCAACAACCTCCATCTGTAAATTCAGTAAATTTGTACTGAATTGACAAGGATTAATATGTAGCTAAGCATCCTCTCA
TATTGATCGATGTCTACCTATACACGGGGCAAATTAGTTACCAAGTTCCAGATTCAACAGAGATGAATATATGTACCACAAACAATAGGGATTGCTCTTG
ATGGACACGATGATCCATAGCATACTGCACAGACTGCTAACTTCTTCAGGAATTGATTGTCGATGGCCGTCTTGTAGGTAGACACGGCCTGCTACAATGC
AAGCTTCTCCCACTCACAGATCCGACGAACCAAGCCCGACCTCGCTTGTCTCCAACAACTGCCCATGGCCGCAGCCAAGGCCACAACTCTGGCGGCCGCG
TCCGAACACCACCAGGAGATCTCACGGGCGTCCCTCTGTTAAGCATGACGAACATTGCCTGTGTTCACCTCGACTCGGCCACCACATGGGACAAAGACCC
GTCGACAACCCTCACCATCACGTCTATCTAGATCAGCAGCCCATTTTTTAGATGGTGTAGCTGGCAAGTCTTCAAGTCTGCAATGTAACTCGATCTACAG
AGCTTCCCCAAATCAAATGTTAACCTACATCAAAATAAAGCCTCCACCTGCCAAACTGACATGCCTAGTGCTGATAACTTCATTAGTGGCCCTCGTAGCC
CTCAAACACCTCGCTCATGACTGCTTCCCTTGACCACCTCCATCTTGTTCGCGCTTGGGGCTTGGGGAGGAGGCCGCCGGCAGTA
page-top