Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

rwhcs10d21
Contig Information
Length 904 bp
Tissue Callus
Clones 1 Clones [Download: CSV  ,  FASTA ]
rwhcs10d21   
Homology (BLAST) Top Hit Os05g0324300 [Oryza sativa (japonica cultivar-group)] >gi|55168315|gb|AAV44181.1| unknown protein [Oryza sativa (japonica cultivar-group)] >gi|113578750|dbj|BAF17113.1| Os05g0324300 [Oryza sativa (japonica cultivar-group)]
Score 240
Evalue 1.21854e-18
Total Hit Count 24
Registered year 2003
Contig Sequence     [ Download ]
>rwhcs10d21
ATGTTCTGAGTTTAACAAACTAGTTGCATTTCTCTTGAGCCCGATTATAAAAACTTGCTATACCGCCCACATGACTTTCAAAGAAGTCAAATCTATTTCA
TTTGTACATCCTCTAGCAGAACTTCCAGCCCTCACAATTCTCCCCTTCTTTTTAAACAAATAACAGACAAAGCAAATATGTGCCATCCTTTTAAAAACTA
TATTTAATCCGATTGCACCAACAGTGTCAACTAAGGCTGACGAAGCGTTTTTCAATTGGCATTTCCCCTGCCAGAAAATAACGGTGACAGAGTTGGTATG
GGCCTTTAAGGATATATCTTCTCTGAACAGCTTCTTGAAAATTGATAGAATGCACCGTGGTAGTTATCTTTGTGCAACCAATAGCACTAGCGTTGGCCAC
GCTCTCCGAAGCTTCCTTCAGTACATCGCCTATGTTGCTGATGTCCATGGTAAATCATGTATTCAGATATTCCCCCTGCATGTATCCATAAGCTGATGCT
TCTTCTCCATGATGTTGCGGCTAGTCCCCGAGGGATTCTTGTACCGGTGCAGGAATATGTCTGTGTAGACATGTAGGAATAGGATAGCCTCCTCAAAGGG
TTTCTGTGTATTGTGTCCAATGCTGGACCAAGGCGGGCTTGTACCACCGCTAAGTGACCCAGGATGATGCTTAGTTTCAAAGATGACATTCTTGATCTCT
GCCGTGATCTGAACGTTCTTGGTATGCCAGAAGTTGCACCAGATCTCCTTGGCTCCTACCAGATTCATCATTTTCCCCATGATAGACTCAGAGAAACAGG
AATTGAGAAAAACTGTATTGCCCCATGGAATTTGACGACCACAGCCTTGACTCTGGCTGTAGGCTCATGAAAAACAGACCAAGCCACACGGGCAACTCTC
NGGC
page-top