Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

rwhcs10d24
Contig Information
Length 560 bp
Tissue Callus
Clones 1 Clones [Download: CSV  ,  FASTA ]
rwhcs10d24   
Homology (BLAST) Top Hit plus agglutinin [Chlamydomonas incerta] (no hit)
Score 82
Evalue 3.1019
Total Hit Count 0
Registered year 2003
Contig Sequence     [ Download ]
>rwhcs10d24
AGTGCTCGATCATAGACGAGTCAGCGGAAGCAACAATATCTGAGTACAGACATAAGTTAAACAAGTTTGCCTTAAGAAGGCTAACACAAAAGTAGCAACG
ATCGAAAAGGCAAGGCCTCCTGCCTGGGACCTCCTAACTACTCCTCGAAGCCGAACTCCACGTAGAATCATCCTCGGGATCTCTAGCTCCTGGACTCCAG
CATCTGGTTGCTCTGGCAAGAAGGAGGGGTGGTCGTCGATGTAGTCGATCTCGGGGGTATCGGCAACGGTCTCGGGGTTAGGAGGAGGTCGGGGACGTGC
TCGCATAGGTTGAGGGGGCGCCGGAGGTGGGGATCGACGACGACGGCCGTGGCGGCTGTGGTGGGGATGGCGGCTCGATGTGGAGCATACAAGGCCCTTT
GGCCTCGATCCAGAGGCGTAGGTGAAGGAGACGAGGTTGGGGAAGCTCGTCGCCACCTTGTAGCAGCTCGGGGATGACCCANAGAATGGCAACGACGACG
CGGCGGCGACGGCAACGCACGGGCGTCNAGCAGGAGAGGCGAGAGAGANANANAACTANT
page-top