Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

rwhcs10e09
Contig Information
Length 418 bp
Tissue Callus
Clones 1 Clones [Download: CSV  ,  FASTA ]
rwhcs10e09   
Homology (BLAST) Top Hit unnamed protein product [Oryza sativa Japonica Group]
Score 315
Evalue 1.68718e-31
Total Hit Count 39
Registered year 2003
Contig Sequence     [ Download ]
>rwhcs10e09
GCAGAGAGAANATATTCCTACTTCATAGACAACACNGGGGGCGACTCCNGGACATTGCGNGAGTANCCANCTTTGATCTACTTGANACTANCCTTCCAAG
CATACACAACTAACCTGCCACGAGCCTTTCTGGTCTCAAACTAACGAGCTCGCCAGAGAGAGTTCATGTATTTCAGTCAGCGTCCACTCCTCTCCAGTTT
GTCCTCCAAGAACTATTGCCTTTGATCCTTCCATGACACATGTACTGTGTCCCCATGCAAACCTCGGAGGTCGCCCTGGGACGTTCANTATTCTCCAGGT
GGGTTTCTCTTCNGTCGGATCCNNGANGTANANCTGTGAACANANTGAANACCTGCTACTGANCCACCNAATATCNTAATTCTCCCTCCNGGTANGCTCA
CNNCAACNTGATCNANGC
page-top