Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

rwhcs10e12
Contig Information
Length 366 bp
Tissue Callus
Clones 1 Clones [Download: CSV  ,  FASTA ]
rwhcs10e12   
Homology (BLAST) Top Hit hypothetical protein OsJ_001395 [Oryza sativa (japonica cultivar-group)]
Score 359
Evalue 6.97738e-33
Total Hit Count 51
Registered year 2003
Contig Sequence     [ Download ]
>rwhcs10e12
CAGGAANTACNGATNCTATTCAAGAAGGGTNAACAGCTGATCTAATTTCAACAGATAAATGTGGCTGCAACATATCAATGTCATTTCCTTCCACGTGACA
GCTCAAAATTGTTGCTTCTGGGCGTTCAAAAACCACAAAACCAATACCANAGATGTCCTCCTCATCGACATCAACTGATACAGATTCTGGTGAAGCACGC
TCAAGTGCTGCCAACCTGANATTATCTTTTGCAACTACTCTTATTGAGNAANATGANCCNNGGATAANTCCTCTCAANCGGAACCTACCANAGGAATCTG
NANNANCTTCCTCATAATAACCTCTTGATTCNNATCTANNTTCNNNAAAAANNCCTTCCTTTGGNT
page-top