Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

rwhcs10e16
Contig Information
Length 671 bp
Tissue Callus
Clones 1 Clones [Download: CSV  ,  FASTA ]
rwhcs10e16   
Homology (BLAST) Top Hit Os12g0502700 [Oryza sativa (japonica cultivar-group)] >gi|108862715|gb|ABA98642.2| DnaJ domain containing protein, expressed [Oryza sativa (japonica cultivar-group)] >gi|113649338|dbj|BAF29850.1| Os12g0502700 [Oryza sativa (japonica cultivar-group)]
Score 426
Evalue 2.79784e-40
Total Hit Count 100
Registered year 2003
Contig Sequence     [ Download ]
>rwhcs10e16
TGATCNCAGCATGACCTGTTTCTTCCAAATGAGAAAACAACTTGCTCCTTGACTCAAAAGTATCTCCACATGTTTCACAATCATTGCTTGCCTTCGAAAC
CTCCTTTTGCTTCTTTCCCTTTGATGTGAACTTTAGGTCAGCAGAAACAGTTGTTTTCTTCTCTGCGCCTTTCTTGTTCTTTTTGTTCTTTTTAGGATTG
TCAGTCTTTTCGTTCTGTTGGCTTCCAACGCTTGCTGATGTGCCGTCATCATTAGAAGTGGGTGGACCTTCCGCCTTATCATCAGCATCATTTTCATCAT
TATCATGCACAGATTCCTCATACGGAACATTATTCTTCATACCATGTCCACTATCAGCATAACTACCTTCATCTTGTCCCTTCTTTGATGCCCGCCTCCG
GCGTCCTTTCTTCTTGACACTCTTAACTTCAGAATTTCTATCTTCACTGTTATCATCCTCTGTAACAACAGAAGGAGCTTCCTCTTGAGGAACCACATAG
CCACTTTTCTTGTTCTTACGGCTTGACAACATCGCCTCCAACACACTTGTCTCATCATATGAACCAACCTCCTGCTCCCCATTATTGAAGTCCTTATTAC
CATTGTCTTCATCCGCCACCTCCAAGCCCTCGTCCAACTCCTCACTAGTCTCGAGTTTTTTTTTTTTTTTT
page-top