Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

rwhcs10f01
Contig Information
Length 872 bp
Tissue Callus
Clones 1 Clones [Download: CSV  ,  FASTA ]
rwhcs10f01   
Homology (BLAST) Top Hit hypothetical protein OsI_07409 [Oryza sativa Indica Group]
Score 677
Evalue 3.61548e-69
Total Hit Count 40
Registered year 2003
Contig Sequence     [ Download ]
>rwhcs10f01
CATACATGGNACAATCTGTCATGGATATAGCCATCAGGCGGGTATTATACACCCACATGAAGGAGAATGCTGGTTCTATTAAATTAACCTCCACCCTAGT
CACAGCCTCAGGAACGCTAACTTCGACACGGAGCCAACGGAACTTCTCCAAGCTCACACATCTTGCGAAACAGGAAGCATGTCTATCCCAATTCTGCAAT
CACCATCTGAAAGACAAGCAGCACATATAGTTTTAACCGGGAACAGGTTCGGAAGTAGTAGAATGCCCGCCGCTAGCGCCCGAGTGGTTGTAGCCGATCA
CAGGCATGGATTTCCGAGCAAAGTCAAGAAGCATCTGGCGTTGTTCTTCGCTGGTGTGCGGAAGGCTTGCACGCAGTAGCTCGACGGGCATCTCCCTGCT
GACGGCCTTCGAGGCTTCAGGTCCAGCCATTGAGTTGGATCCCTGCATGCTGAACCTCTGCAGAATGCTCCCATACTTGCTGTCGCAGTATTTTGTCAGA
AGCCCAAAGAAGGCATCGAACGACGCCTGCCAAAGCGAACGGGTTGACCTGCTGTAGTTGGCTGCAGAATGGGGATCGGCCAGTAGCTCAGTTGCTCTGT
CCAGTACTGATTTGATGATTAGAGCAGCACCATCACCAGCAGAGCTGCCAAGAGGGCGGAGAGGTGGCTGCTGCGACGAGCAGACAACAGCTGCGAGGCA
GGCGCTGAGGGCACTGAGCTCCATGTGATGCACGCAGGAGGACACGGTCTTGGCAAGACTAACTGTTGTTTCTGCAGCACCAGAATCTGATGGCAAACCC
CCAAACAAGCTCCTAAGATGCCGAAAGATAGCCATGCAAACTATGCGGGGTTAGCTCACTTCCAGGGGCAAG
page-top