Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

rwhcs10f06
Contig Information
Length 743 bp
Tissue Callus
Clones 1 Clones [Download: CSV  ,  FASTA ]
rwhcs10f06   
Homology (BLAST) Top Hit MAP kinase [Triticum aestivum]
Score 965
Evalue 1.09684e-102
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>rwhcs10f06
GCTGAGGGACAAAGGTTTGAAGAAGCAGCAACAACTTACACAGAATAAACAAACAAATGCAGTGCGCAATCTACCATGTTCTTTGATCTTACTCCTATTT
ACAGACAGTTTTATACCGAAATCATACTGTTGGGGGTTGGGTAACTAGGAATGAATCATCTAGTATCGGAAGTTGGGGTTCAACTCCAGGGCTTCGTTGA
ATATGAGTTGCTTCATCTGGTCTTCCGTCAGAGGGTGCTGCTCGAAGTCAAAGGAGAAGGGGTCCGTGCAGATGGGCTCGTCGGCGACGTCGTGAAGCCG
CTCTAGGTACGGGTGCTCCAGCGCCTCTTCAACTGTGATCCTCTGCAGCGGGTTAAAGGTGAGCATCCTCTCGATGAGGTCCAGCGCGGCGGGCTGCACC
TTGGGGAACTGGCCCGGGAAGGACCGGCGAGGGAACTGCGGCAGGTGCCTCATGTACCTCCTGGCGTCCTCGTTCCGGATGAATCCCAGGTCGTCGTCGG
TGGGGGTGCCGATCACCTCCGTGATGAGCCGCATCTGGTGCATGTGGTCCCTCCCCGGGAAGAGCGGCGCGCGGTTGATGAGCTCCATGAAGATGCAGCC
GACGGACCANACGTCGATGGCCGCGGAGTANTCGGTGGAGTTGAGCANCANCTCCGGGGCCCGGTACCACCGCGTGACCACGTACTCCGTCATCATGTCN
CTCTCCNATGACNGCCGCGCCANGCCNAANTCNCANATCTTGA
page-top