Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

rwhcs10f17
Contig Information
Length 895 bp
Tissue Callus
Clones 1 Clones [Download: CSV  ,  FASTA ]
rwhcs10f17   
Homology (BLAST) Top Hit hypothetical protein OsI_31894 [Oryza sativa Indica Group]
Score 358
Evalue 3.71577e-32
Total Hit Count 48
Registered year 2003
Contig Sequence     [ Download ]
>rwhcs10f17
TCATCTTTTAATCCCGTCTATGTACAAATATTTACAGCGACAAAATCAACTTGCACTTCTACAGCAAGTATCTTCATCACCTCTTCCACCAAATGGGCGG
TCCTACCTTTTGTATTCCAAATGGCTGGTCAGGGGCAAATCTCCAAAAGACCTACCTACGTCACAAGAACTTGTCTCACAAAATCAGTTGACATGTCAGC
TTCAGTAACTAACAATTCAAGCACCGCTACGGGCCTTGCCTGCACATCAAGGCAGCCACAGTATTCCGCGATCAGCGCATCATGTTAAAAGCTGCTAAGG
ATCATCCACTACCACCTTTGCTACATGGTCTCATTTTTGTTTCTTCTTAGGCTTCTTTGACGATATAAGAGCTGAGGAAAGTAAAGACTCAACGTCCTCC
CTTTGACGCTTCCTCGCTGCAATTTGGTCCTTTTGACTAGTTACAGTTTGCTTAGCAGCTTGGCTTGTCGTGAGGTCCCGTATATGGCTGCTTGTTCCAT
CAAAATGTGATGAAACTGATGGATCCACCTGATTCGAGTTCCCAGATCTTGGTTGTTCGGTAAACTTCCTTGCCCCCTTGACCTTATTTTTCTTCATATC
AGGGATTGTTGGTGGACCAGTACCACTGTTCCTATTTGCTAATTCCGAAACTGCGTCATCTTTAAGCAAGGAACCCTCTTTGTTTGAATTACTGAACCTT
GGTGTTTCAGAAAACTTCCTTGCTCCTTTAGCCTTTTGTATCAAATTCTGCATTTCACAGTGTTGTGCTGATGAAGAACCATCATCCTGCTTGGCCACTG
ATTTTACAACAGAATCATGTTTTGACGAACCCTTGATGGTTCCCATATCATTGTTTTGGTTGGCAGCCTTTTTGTCGNAATTATGTAATCTCACC
page-top