Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_CSEC_all.Contig1608
Contig Information
Length 178 bp
Tissue Callus
Clones 4 Clones [Download: CSV  ,  FASTA ]
whcs10b14    whcs9h09    rwhcs10b14    rwhcs9h09   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein [Vitis vinifera] (no hit)
Score 193
Evalue 2.15168e-13
Total Hit Count 0
Registered year 2003
Contig Sequence     [ Download ]
>Wh_CSEC_all.Contig1608
CTAGATCGGTGGTGGTTCGATGAGTCTCTGTCACAGCGTTTGGTCGATCGGTTGATCTTGTTAGGCATTCTTTCTTTTTGTCATATATATATCCGCTACA
TTATACTGCTGTGTGCTGTTTTATATGAGATTGGGTTGCTATGAATAAAGCATGATGATCCCGTGATCAAAAAAAAAA
page-top