Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

rwhcs2j21
Contig Information
Length 741 bp
Tissue Callus
Clones 1 Clones [Download: CSV  ,  FASTA ]
rwhcs2j21   
Homology (BLAST) Top Hit Os12g0153600 [Oryza sativa (japonica cultivar-group)] >gi|113648689|dbj|BAF29201.1| Os12g0153600 [Oryza sativa (japonica cultivar-group)]
Score 252
Evalue 5.21457e-20
Total Hit Count 11
Registered year 2003
Contig Sequence     [ Download ]
>rwhcs2j21
GCAATCCAATACAATGGACCTAACAGTAGGAAAAAAATTCTGTGAAAATATTTTGGCTCTGTATGTAACGATGCAACCAGTCACTTGCAGCACGTTAAGA
AAGTACCAGTATGATCCCTAAACAAGCCTTCAGAGAGAAAACAGCTATGTGCTGCACTAGCAGGAAGACAACAGCAAGTCTGAACCCGTTGACGATCAAG
GTTTTTTTCAAGAATAAGTGCTTCACTATCCAGATGGCCGACGCTCCTTCAGCCGCCCAAAGGATTGTCGGCGGCCGCCACTCCCGGGAGATGATCTGGC
CTGCTTTTGAATTGGCATTAACGGTAGAGATTCGCGTCGCCCTGGGGCAGCCCGCCTGACCCACCAGAGGTACAAGATGAAGATCAATAGAATGATGAAG
ACAGCTGCAAACAAGATAAAAAGGATCTTGCTGCCATGTGAATTTGACGGAGGCCTCTCCATGACGGTCTCCTTACAAGGAGGGGCAATCTCTTTTCGTG
AACAAGCTTTGCCGCATACCACGACAGGAAACGACCATTTTGCAACAACAGCTCTGTCCTTTCCATGGCAAGAGATATATGTTGCTGCCAATTCAGGATA
ATGAAGCTTTGCCCTCATGAAACGGCATAAACAACACTTTCCATTCTCACCGCTAGCCGGCAACTCGTCAATTGCATGTATCAGTGCTTTGCAGCATGAG
ACTGAGGGTGACTTCCATGACTTGTCCGGTTGCATGCATGA
page-top