Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

rwhcs2k11
Contig Information
Length 757 bp
Tissue Callus
Clones 1 Clones [Download: CSV  ,  FASTA ]
rwhcs2k11   
Homology (BLAST) Top Hit unknown [Zea mays]
Score 404
Evalue 1.27202e-37
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>rwhcs2k11
ACTGAGCATAAATGGAACATTTTTCTACTAAATCATCAATGAAGCAACTAAAGACCATATTTGAGGATCACATGAACTCAGGCTAAGACGGCATAAAACA
CACATAGGAAAACATTCTTATGCTTTAATATTGCAGACGTACAAACTATAAACTTATGGCGCCTTGGCCAGCATAACTTCTCTATATAATTCCAGCGCCT
CATCCATGATATTTGCTTTAGATAAAAGCTGTGCTCTTTTCTTCCCCGAAGGATGATATATGTCATTCCCAGCTAGCTTCTCAACGGTCTTAGGGGCTAT
GTGTGGATCGAAACCAGCAGCAGCCATTATCAGCATTCCCATGCGATCTGCCTCTCTCTCGATCCTTCGTACGAAGTACACCTTGAGAGGATAAGGAAAC
CACTTCTTATATATAATTAACTCTGACCAGTGTCTGGCAACCAAATGTGCAATCTCATGTGCAAGAATAGTAGCAATTTCGGCATCAGTCTCCAAATTAT
TGAGCAATCCAGTGAACACTAAAATTTTGCCATTGGACCATGACACTGCACCCATATGCTGATCATTTTTCATAACAAACACCTCCAAGTCAAGACCATC
AAGGTGAGTTATCTGTGGCTGTGATCTGCATGACTTGCCCTGTTTATTGCTCTCAACTGCATGCCTACCATCTAAGCTCGCGTCTTTGCCAGGGGAGCCA
TGGACCAAGGCCGCATCAGAACCCTTGATATCANGGCCACGTTGAACGGCGCGAACA
page-top