Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whcs10o09
Contig Information
Length 814 bp
Tissue Callus
Clones 1 Clones [Download: CSV  ,  FASTA ]
whcs10o09   
Homology (BLAST) Top Hit predicted protein [Postia placenta Mad-698-R]
Score 82
Evalue 3.17083
Total Hit Count 3
Registered year 2003
Contig Sequence     [ Download ]
>whcs10o09
GCTCCTGCCTTCGCGGCCTCGCCCTCGCATCACTCTAAACCGCCATCGGGTGCGCCTCCTCGGCGGCGGAAGGCGAACAGCGAGGAACCCTAACCCTAAC
AACCAGTAGATCCGATCTGCAAGGCCTGCGACGATGGCGGCTTCCCTTCGCGCGGCGGCGACGAGGATCCTCCGTCCGGCGGGCCAGGGGCTTCGCCGGC
TCGTCCACACCCAGGAGCATTCTGGATCCACCCGTGCCTTGGAGGAAGGGTACCCTGCAGCGCAAATCCAGCAGCAGAAGGAGGAGCTGTACGATCTCAT
CGCCGACGCCTATGCCAATTCCGCGTCTTCCCCTGCTGACAGATATGTGCTCAAGGTTCTCTCCACACAAATCAAGCCGAGACCACGTGACCCTCAGTGG
TGTGAGATAATTACAATCAAGAAGGCGGGCAACTGGGCTCTGGGAGGTTTTTGTTTTGTTGGTGGTAGCATAATTCTTGCTGGCCTTGCTCAGGGTGTGC
GTAAGCGAGCGGAGCTCGAGATGCCCAAGCCTGTGGAGCCATACAGAATCAAAAGGAAACTGCAGAAGCAAGTCGAGTGACGACGAAATGCATCTTGTTT
GATGGAGAAGCAAGGCCGATATTAGTTCTTCTCCAACGCACTCTTATTCAGGCCTCTTAAACTATGGCAAATTGTTCGGGTTTATCATTTCTGTAAACTA
TATATATGTCTATGATCTGCCACCTATGACTGANTAGTACTATTACTGGATGATCTTTGATCGCATTGTAANATATTTGTGATGTTGCTGACATCNTATG
TTGTAAAAAAAAAA
page-top