Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

rwhcs2l19
Contig Information
Length 310 bp
Tissue Callus
Clones 1 Clones [Download: CSV  ,  FASTA ]
rwhcs2l19   
Homology (BLAST) Top Hit unknown [Zea mays]
Score 286
Evalue 2.03831e-24
Total Hit Count 281
Registered year 2003
Contig Sequence     [ Download ]
>rwhcs2l19
CNCTTGGTTGTTCATCATATCCCANATGTTCTGAGGGGATCTTCTTTGCTTCCCATCATAGGAGGAAGGGCAAAGGAAAAATGGTAATAGTACACACTCT
ACCGCCTTAGGCTGTGCATAATGTATTCCCCGTACNGATCCATGGAGTGTTGGATGGCAGCACGAGCATCATCGGNGGGGAGGAAGTCGTTGACAGCNAC
CTCCTTGTTCTCATTCTTCTTGTAATCTTCAAAGAAGCGGCGGATCTCCTGGAGGCGATGAGGAGANAGCTCGCTGANATGGTTCNNGTTGTGGTACTCG
GGGTCGTCGG
page-top