Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whcs10n01
Contig Information
Length 831 bp
Tissue Callus
Clones 1 Clones [Download: CSV  ,  FASTA ]
whcs10n01   
Homology (BLAST) Top Hit hypothetical protein OsI_08604 [Oryza sativa Indica Group]
Score 674
Evalue 7.47023e-69
Total Hit Count 103
Registered year 2003
Contig Sequence     [ Download ]
>whcs10n01
CGCTCCGCTTTCTGTTCTTTTCTCCCTTCCTGCCGCATTTATTATCTATCGCAACATAGTCAGACAGACCAGAGTACCACCACCACCACTACCACTACCA
GCAGCCCCCCTTCACACAGGGACACACACGCTTCCTCCCCCTCTTCTTCTTCTTCGCTGCCCTGCCTCCTCCGTCTCCTCACGCTCGAGGCCTGCCTCTG
CCTCCCTCCATCTACACTGATCCATGCCGGAGCGCTCCGGCCGCTGACACCTTGCCTCCGAACGACGCCGCAAAGGTTTGGTGCCCACTGATCGTGCTTG
CCGGGGAGGAGGAAGATGAGGATGAAGACGCTGGCCTGCTGCCGGCGGCGGCCGCAGGACTTCAGCGTCGACATGGACCAAGAGCCGGAAAAGGTGACGA
CATACAATGGCCTCGAGAGCTGCATTTTCAACAGTTCCTCATATGATGAGGATAGTGGCGTTAGTGCAACAACAGGGGCGGATGGCTGTGTCACCGCTGA
TTCCCTTGAAGATGAAGCTTCAAGTTGCTCCTCCAGCAAAGATGTTGATGGCTCTTCCTTCTCTTCCCAATGCCTTCCACTGAGCAAGCAGGAGGAGCAT
TCACTTTATGAGTTGGATACACTCGATGCTATCCATCTACTCCCTGTCAAAGGGAAGAATCCAATCACATATACATTGAGTGCCGCTGATATTGAAACCA
TGAAGGAGAAGTTTGCAAAGCTACTGCTTGGTGATGACGTTTCTGGAGGTGCCAGAGGAGTTTGTGCTGCTCTGGCCTTGTCCAATGGCATAACCAATCT
CTCANCCACTATTTTTGGAGAGCTGTGGAAA
page-top