Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whcs10k03
Contig Information
Length 827 bp
Tissue Callus
Clones 1 Clones [Download: CSV  ,  FASTA ]
whcs10k03   
Homology (BLAST) Top Hit Os11g0137300 [Oryza sativa (japonica cultivar-group)] >gi|113644400|dbj|BAF27541.1| Os11g0137300 [Oryza sativa (japonica cultivar-group)]
Score 906
Evalue 9.23257e-96
Total Hit Count 13
Registered year 2003
Contig Sequence     [ Download ]
>whcs10k03
CCAGCAGCCTAAGCTGCTGCAATCTAACGATCAGAGTGATGGAAAGCTGCTATTCCCATCAAAAACATTTCTTGCAATGATCAAGTTTCTGATGAAGTGC
TTTGAGGCAAGTGATATTCCAGATCTTTCGCAAGAAGATCCATCTCATTCCCCAGTAGCAAAAATGTGTGTGGTCTTAGAACATGCCATGTCGTACGAAG
GGTCTAGTGAACTGCATGCATTGGCCTTGAAGTCATTGGTTGATATATCCTCTCGTCAGCCAAAGTTGGTATCGTCACGGTATGCCAACCGTTTACATTG
GCTGAGAACTTTACTAAGTCATGTTGATTCTGATGCTCGTGAAGCTGCGGCCCGTCTGCTTGGCGTTGCTTCTTCAGCACTTTCAAGCTCGGCTGCATTG
AATCTTCTGTCTGAACTCACTTCAGCACTTGACCCAAATCATCCGTCAAGATTTGAGATTTACCATGGATTGTTATGCGCAATCGGGTATGTAACCGCCT
GCTGTTTGAAGGAATCTTATATACCTGAAGAACTGGTCCAAAAGGTAGTTGATATTCTTGTAAAAGTTGTTGAGTCTGAGGGTTCAACATTGGCATCACT
TGCAATGGAATCTCTTGGCCATATTGGGCTCCGTTGTGCATTGCCTTCCATTAGTAGGAACTCCTCTCCAGCTGGAGTTTTAACTGTTCTGCATGAGAGA
TTAACAAAGCTGCTTTCCGAAAATGATACCAAAGCTATACAAAAGATCTTGGTATCACTTGGACATATTTCATGGAATGAGTTGTCCTTTTCACATCTGA
AAATTGCGTTAGACTTGATTTTCAGTC
page-top