Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

rwhcs3j07
Contig Information
Length 858 bp
Tissue Callus
Clones 1 Clones [Download: CSV  ,  FASTA ]
rwhcs3j07   
Homology (BLAST) Top Hit unknown [Zea mays]
Score 180
Evalue 1.51143e-11
Total Hit Count 12
Registered year 2003
Contig Sequence     [ Download ]
>rwhcs3j07
CTGACTGCACTTCAGATGGGAAAATCACGTGTATCCAGATCAGGGGTATCTGTTGACCTGATAACACTGATACAAAATGACAAGCTCAACGACTTGTTGC
GTTGAGAAAATGCATCAGGACAGGTAATTAAGCTGTCTACCTGCATTTCCAATTCACCGCACTAGTGTTACCCACAGTACAGTTACATTACACGCTCATT
CTCGCACAGACCAAAACGGCTTCTGCCCTGAACTGGGAGCTGTATTCCCTCCAGGCACGCTAGTCGTCGTCCTCTTCATCATCATCCCCGTAGTCCATAA
GCTTCAGCAGAGTATCGGAAACAGATGCACTGCTTGGCTTTTCCTCTTTAGGCTCCTTCGGAGGTGGTGCAGCAGAACTCGATCTCGGAGGCGCCAGCAG
CTCCTTTACAGCTGAATGCCTGTTCTCATTTCTTAACACTTCATTTGAAGGGAACTTAGGTGGTGGCGGAGGCATGCTCCTGGGCGGTGGCGGTGGCATG
CTATTGGGATATGGCAGTGACATGTTCTTGGGTGGTGGTGGTGGCGGCATGCTAGTGTATACAGATGGATGAGATGGATGTGGATCTTGTGGAAGTATCC
TATTTGATCCAGGCTGAACTTTCATTGTAGCTGCAACCGATGAACTGTTCATTTTACCTAGATCATCTAAACCTGTCTTAACAAATTTGGACCCCTGTTG
TGAGTTCTGGAAACATGAAACAAAAACACTTTCCCATCAAATTCCTTTGCATTGAATTAAATTAAAGCATATTAATGGTAAAATGCAAAANAAGGATGAA
ATCANCAACTACTGTCCACAAACANCACCACCANTGCATAAAATACATGAATTATATC
page-top