Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whcs13i17
Contig Information
Length 786 bp
Tissue Callus
Clones 1 Clones [Download: CSV  ,  FASTA ]
whcs13i17   
Homology (BLAST) Top Hit hypothetical protein OsJ_019078 [Oryza sativa (japonica cultivar-group)]
Score 1183
Evalue 6.39277e-128
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>whcs13i17
GGCAGCTCCAACTGGCCTTGTATCAGACAAGAAGCCATTTTCATTATCATCTATCTCCCTTGCCGACAGGCCACGACATGTGCGTCTTCAGAGGAAATGC
AACTTCAGAGTTAAAGCAGCTAAGGAGCTCTACTTCAACAAGGATGGCTCAGCCACCAAGAAGCTACAGGTTGGAGTAAACAAGCTTGCAGATCTTGTTG
GAGTTACCTTGGGACCAAAGGGAAGGAATGTTGTTTTGGAGAGCAAGTACGGGTCCCCCAAGATTGTCAATGATGGTGTTACAGTTGCAAGAGAGGTTGA
GCTGGAGGACCCTGTTGAAAATATTGGAGCTAAGTTGGTTAGGCAAGCTGCAGCGAAGACCAACGATTTAGCTGGAGACGGGACAACTACTTCTGTCGTC
CTTGCTCAGGGGCTCATTGCTGAGGGTGTTAAGGTTATTGCAGCTGGTGCTAACCCTGTTCAAATTACTCGTGGTATTGAGAAAACAGCGAAAGCACTAG
TCCTTGAACTTAAGAAGATGTCGAAGGAGGTTGAGGACAGTGAGCTTGCCGATGTTGCTGCAGTCAGTGCTGGCAACAACTATGAAATCGGTAACATGAT
AGCAGAGGCTATGAGCAAGGTCGGACGGAAGGGAGTGGTTACCCTTGAAGAGGGGAGGAGTTCCGAGAACAATCTTTATGTTGTGGAGGGAATGCAGTTT
GAGCGTGGTTATATCTCTCCTTATTTCNTTACTGACAGCNANAAAATGACCACCGANTACNANAACTGCAANTTGCTTTTGGTTGA
page-top