Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whcs10i01
Contig Information
Length 817 bp
Tissue Callus
Clones 1 Clones [Download: CSV  ,  FASTA ]
whcs10i01   
Homology (BLAST) Top Hit hypothetical protein OsJ_033095 [Oryza sativa (japonica cultivar-group)]
Score 454
Evalue 2.31904e-43
Total Hit Count 27
Registered year 2003
Contig Sequence     [ Download ]
>whcs10i01
CCCGCTCTTCCCCTCCGTCTCTCCCCCCTGCCGCGGCGGCGCGGCTGTGCGATTCCTTGCGGCCGCGGCTCACGGGACCAGCGGCCAGGGGATCAGTGAC
GGCAAGGCTCGGCTCTATCCTCTCCTCTCCCTCCTAATCAAGCTTTCTCTGAAGTATGGCTTGTGGACAAGTGTAGAACTGTAGACAAAGACACAAAGGA
ATTGCTGGCATAAGTCTTCATTTGAGAAAGATCAGTTGGCAGCTTACAATGGCTGGAAATCAGCAGCCGGCTTCAGTTGTGTTGGATTATGCAGCAGTCC
TCGACGCCAAACCCTTGCGCACACTGACTCCCATGTTCCCTGCACCGCTTGGGATGCACACTTTCACCCCTAAAAGCTCATCTTCAGTTGTCTGTGTCAC
CCCATTTGGACCATATGCTGGAGGTACCGAACTGGTAATGCCTGGTGGTGTTCCGCCAATGTTAACATCACTGTCTGCTCCTGCAGATCCCAACCAGGTG
CAGCCATATACGGCTCATATGAATGGAACTTCTAATGCTAATGGTACTACAAACAACACAATGGTTACCCCTGTGTTGCAAACTCCTCCAGCAGTCACTA
CACAGGAATCTGGTAAGAAGAAGAGGGGGAGGCCCAGGCGTGTTCAAGATACCACTACTGTTCCTTCAGTTCCTCCAGTTCAACCGGTTCCTACGGTTCC
TTCAGTTCCTCCAGCTCCTTCAGCTCCTCCAGAAGTTAATAATATTGTTCTCCAGACACCTCCTGCAGCCGTCACACAGGAATCTGGCAAGAGGAAAAGG
GGACGACCCAAGCGTGT
page-top