Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

rwhcs3j10
Contig Information
Length 514 bp
Tissue Callus
Clones 1 Clones [Download: CSV  ,  FASTA ]
rwhcs3j10   
Homology (BLAST) Top Hit hypothetical protein [Oryza sativa (japonica cultivar-group)] >gi|54287481|gb|AAV31225.1| hypothetical protein [Oryza sativa (japonica cultivar-group)]
Score 157
Evalue 2.15726e-09
Total Hit Count 29
Registered year 2003
Contig Sequence     [ Download ]
>rwhcs3j10
GCTTTGTGTCTTGCTCTTCTTCNTCCGCCCACCTGATGGTTTATCGGNCTTTGCTGCTGTCATCGAACCTGCTGAAGCACGTTTTGAGTGCTTTTTTGTC
GCTGTGCCTTGGCAACATTATCANCAATTACTGTGCAAGTAGATATGTTGNGGGTTTCAGAACCACATCGGCTACAGTGAATTTTTGGTTTCACACGCAA
AGTTTCCATGAAGGTTTTGTATCGCCCTGATTGTGGACGTCCTTTTGAGATAGCAACATCGGGATTTTGCAGGTTGTCCCCATAACCATCTGGATGTGGG
CCTGTGAGTGGAACTTCTGAATTCTTTGGTCCAACACTTGTTTTCTCAGCTTCAGCAGCTTCATCTTCTTTAGTCATCTCATCCAATCTCTGTTGCACCC
TCTCACTCTCCCCAACAACATATAGATATTTTCTATTTGTNGATGCGCCATCAGAGGCCATATCGNTGAGCCTGTTGGACAAAAGTGTGTACCTCAAGTG
TTGACTCCCAGCAG
page-top