Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

rwhcs2p13
Contig Information
Length 745 bp
Tissue Callus
Clones 1 Clones [Download: CSV  ,  FASTA ]
rwhcs2p13   
Homology (BLAST) Top Hit Os06g0556000 [Oryza sativa (japonica cultivar-group)] >gi|53792565|dbj|BAD53554.1| putative amino acid transporter [Oryza sativa Japonica Group] >gi|113595893|dbj|BAF19767.1| Os06g0556000 [Oryza sativa (japonica cultivar-group)] >gi|125555719|gb|EAZ01325.1| hypothetical protein OsI_23356 [Oryza sativa Indica Group] >gi|125597558|gb|EAZ37338.1| hypothetical protein OsJ_020821 [Oryza sativa (japonica cultivar-group)] >gi|215734984|dbj|BAG95706.1| unnamed protein product [Oryza sativa Japonica Group]
Score 846
Evalue 6.86975e-89
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>rwhcs2p13
CAGATACAGTCTACAGATGACACCTTTTTCTCGAGAAAAAACTTAAACAAACACAAGTCAAAGAATTTCTACTCACAGCTAAGCTAATCCATTTCACAAC
TTGGTCTTGAACGGCACATAGTTCTTGAGCGACTGGGTGATCCCCTGGATGGAGGCGACGGTGACGGCGACGGTGACCACGAAGCACGCGAAGCTCAGGG
TCTGCAGCGCCACCCACTTCCTGGAGTACTTCTTCATCTTGCTCTGCGAGATGTACATCTCCACGGGGAAGTAGACGGTGAGCGGCCAGAAGCCGAGCGC
GCCGAGCAGGCCGAGGATGTCGTTGAAGAATGGCAGCGAGATGGCCAGCACCGTGCTCACGATCACGAACGCCGTCCTCCACACTAGCCTGAACATGTTG
AGGCTGAACTTGCCCGAGAAGGGGTAGTACTGCCGGACGACGAACTCCGAGTTGGGCCACCGCCCCGCCGCCCAGCTCTCCACGGCGGCGTAGATGGGCT
GGCAGTACACCTGGTAGGCGCCGACGAGGTGCACCACGATGCACACGTTGGCGAAGTCGATGAGCCAGTAGGGCTCGTANAAGCCGAAGCCGGTGAGCAT
GTTCCCCGGCGCGTCGTTGCCGAAGGCCGAGTANCCGAGGCACCCGCANAGCATGTANAAGGCCGTGGTGGTGGANACCCCCATCAGGTTCNCCTTCCTC
ATCNTCTTGTTTTCNGCCGGNGGCNCCTTCNCCNTGTCCTGAATT
page-top