Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

rwhcs2p14
Contig Information
Length 763 bp
Tissue Callus
Clones 1 Clones [Download: CSV  ,  FASTA ]
rwhcs2p14   
Homology (BLAST) Top Hit hypothetical protein OsI_00555 [Oryza sativa Indica Group]
Score 533
Evalue 1.4232e-52
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>rwhcs2p14
GTTCCGTATGATGTTACATCTCAGGCCAAAAAAACAAAGAGATAGCACTGCTAGTTTGCTAAATTCTAGCTACTGAATTTTCCAGACGAAACCGGGTTAT
TCCGGGGGAATGACAACGCTCCTTCCTCGCTCCACGACGCGCTCCAGATCCGCGAACCAGAGTTTCAGCAGCGATTTCTCTCTTGCGATGCTCTCAAGTT
TCGGCTTCAGGTCCTCGATGCTCTGCTGCATCGTCAGGATCTCAGCTTCATGTCTGAACTTGTCCTCCGACAGCATTTCGGCGGCATGGACGAGCTCCTG
CCTCTGCCTTTCGGCTTCGGCGTTCGCCTCCTCCAGCTCCTTCACCTGGTCCTCCACTAGAGACTTCTCTTCAGAAACTTTCTCCAGCTTGAGACTGGTG
ATCCGGTTCATTTCTTGCAGCTTTCCTACCTCTGTGCTGTTGGTGGACTTCTCCTGCAACAGCTTCTCGGACGCGGTGGCAAGCTCTTGCCTGTACTGGC
TGATCTCGGCATCACTCTCGGATATTTTGTCGTTGAAACGCCGTCTAGCTGAAGTCATCTCTTCCTTCAGACTCACAATTTCAGCTTCCAGTCCCTTGTT
TTGTTCCAGCAGCCTGGAGTGCTCTTCTGACAAAATTGCAGCGTCTTCGAGCCTCCTTTCAAGATTGTTGATCTCCACTTGTGAANATTGTANCTTCTCC
TTANTTGACACGAACTCTCCATCAATGTCTCTAATTTTGGTANCATGANCGGCGCCATTTCCA
page-top