Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

rwhcs3o10
Contig Information
Length 670 bp
Tissue Callus
Clones 1 Clones [Download: CSV  ,  FASTA ]
rwhcs3o10   
Homology (BLAST) Top Hit hypothetical protein OsI_07997 [Oryza sativa Indica Group]
Score 813
Evalue 3.72913e-85
Total Hit Count 83
Registered year 2003
Contig Sequence     [ Download ]
>rwhcs3o10
ACAGGACTACATAGAACTATATAGCACGGTCCTTCCAGCAAGACCATCAGACCTGATGAATGATCTAGTCTTATTCTTCAAGAATTCCGTCAACTATCTT
GGCACCCCTTGATTTGGCCATGTAAAGTCCCATGTGATGCATAAGATCCTGTGGATGGGCCAAAGCTCCTTTCATACTCCTGGCTACTTCGACAGGGAGG
TCAAATGTTGCACATCCCTCAGAATAGATCACAACATCTTCCAACGGGGGCACTCGGCCAATGTTTCTTGCAGCCAGCGTTGAACTCACAAAGTCCAAAA
CACAGTAGTCTGTGCATATTCCTACAACCAAAACGGTTTTGATCTGGAACTTTGCGACCCACTCGCTGAAAACATTGGACCCGTCCTTCTCAAATGAAGC
AAGATAACCATCAATGCAGTCCTTGCGCCTCATTGTCACATTTGGATCATTCTCCAGCCACTCCAGAGCTGGAACAAAGTTTTCTTCACCGGAACCGATG
ATACAGTGCGGCGGAAAAGGCGGCTCAGGTTTATCGGGGTGGTGGGTATCAAGGAACGCAAAGACCGGCCAGTTCCTCTGGCAGAACACCTTGGCAAGCC
TGGTANACTCCTCCACCATCTTCTCGATCTGCTTTATTCGGCGTGACANGGGGCGAGGTTCCCGGCGCCG
page-top