Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whcs17d03
Contig Information
Length 861 bp
Tissue Callus
Clones 1 Clones [Download: CSV  ,  FASTA ]
whcs17d03   
Homology (BLAST) Top Hit hypothetical protein OsI_12238 [Oryza sativa Indica Group]
Score 563
Evalue 5.89995e-56
Total Hit Count 99
Registered year 2003
Contig Sequence     [ Download ]
>whcs17d03
AGGACGTACCTGTCTCAAAGAACAATGAGAGTCTTGGTGCTGACATATCTTCTCGGACAGCTATGCTTCCAGAAGCTAATGTTCCTTTGGAGCGAAAAGG
TTCGGTTTCTAGCCCAGCCCCAGAGAAGAGTGCGTTCAGTGATCATGCTGATGAACCTGCATACTTTTCCTCTCATAACAAGCGTCCGGCAGAAGCACCT
CTGCAACAATTGCGTCCTAATACTTATCAGAAGAGAAGTGCACATAAGTTATCTGAGAGTTCTCTGTCATCTGGATCTCATGGACACGATCATAGGTTTT
CCAGAAACCAACCACCTCTGCCACCAATGCCACTACCAACTTCTTCCATGCCTACACGAAGTCCTGAGTCAAGTCAAAGGAGGTCATCATCTTACAACGC
AAGGGACAGCTCTAGGGATGGACCACCAGCTTACCCATCTAATTATCCTGTACAACCTTTTGAGGCTAGTATGCCTACTGCTTTTGTAGGGCTTCAGGCT
CAAACTGAACATGCCCTAGCAAGCAACGGTACTTCATCATCGAATGCTCCTAATGCAGACGCCAATTTCTTGTGGAACAATTTTCCAGTAAATAGGGTCC
CTATGGAGCACTTCAACTCTGGTTCATCTGCCCGACCAATGGCACCCCTTGCTCAACCTTATTCAACCCAACATTCTGCAATGAGCTCTGGCTCTCCTGC
ATCTCATCTGTATAATCAAGGCACTAGTGTTGTCCAGCCTAACCCGTCTTCATCTCTTATGAACGATGCAAATTTAGGCATAAATTCTGCGTCTGGCAGC
GCAATTCTGTCCAATTTGTTGCCATCATTTGCATCACAATTTCTAATGGGTAGGCCTCCAA
page-top