Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whcs10d11
Contig Information
Length 807 bp
Tissue Callus
Clones 1 Clones [Download: CSV  ,  FASTA ]
whcs10d11   
Homology (BLAST) Top Hit hypothetical protein OsJ_011386 [Oryza sativa (japonica cultivar-group)]
Score 1324
Evalue 2.97508e-144
Total Hit Count 200
Registered year 2003
Contig Sequence     [ Download ]
>whcs10d11
TAGTGGCTATTTAATCCGCCCTTGCGAAGGGGGTGGCTCCATGATCCACATTGTAGATCATGTTGATTTGGATGCTTGGAGTGTGCCTGAGGTCCTTAGA
CCACTTTATGAGTCTCCAAAGATTCTTGCGCAGAAGATGACAATTGCGGCTCTGCGTCACATTAGGCAGATTGCGCATGAATCAAGTGGAGAGATGCCCT
ATGGTGGGGGGCGCCAGCCAGCAGTTCTAAGAACATTTAGTCAGAGATTGAGCAGAGGTTTCAACGATGCTGTTAATGGATTTCTGGATGATGGCTGGTC
ACTGATGAGCAGTGATGGTGCTGAGGATGTTACAATTGCTATCAACTCATCTCCAAACAAACTTGCTGGATCTCATGTCAACCCCTCCCAGATGTTTACT
GCAATCGGGGGTGGCGTCTTATGTGCCAAGGCTTCAATGTTGCTGCAGAATGTACCGCCCGCTCTACTTGTACGATTTCTGAGGGAGCACCGCTCTGAAT
GGGCTGATCCTGGTGTTGATGCTTATTCTGCCGCTGCTTTGCGAGCTAGTCCTTATGCAGTTCCTGGTCTACGAGCGAGTGGGTTTATGGGCAGTCAGGT
TATACTGCCACTTGCACATACCTTANAGCATGAAGAGTTCTTGGAGGTTATTANACTTGAGGGACACAGTCTCTGTCATGATGAAGTTGTTCTATCAAGA
GACATGTATCTTCTGCAGTTATGCAGCGGTGTTGATGANAATGCTGCCGGTGCATGTGCGCANCTTGTCTTTGCNCCGATTGATGAATCGTTCNCTGATG
ATGCTCC
page-top