Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whcs10f17
Contig Information
Length 818 bp
Tissue Callus
Clones 1 Clones [Download: CSV  ,  FASTA ]
whcs10f17   
Homology (BLAST) Top Hit hypothetical protein OsJ_028719 [Oryza sativa (japonica cultivar-group)]
Score 696
Evalue 2.02741e-71
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>whcs10f17
CAGTACCGAATGCATCCTGACATTAGCAGATTCCCGTCGTTGCATTTCTATGAAAACAAACTGCTGGATGGTGCTCAGAAGGCTGAGAAATCAGCTCCTT
TCCATGATCACAGTTGTCTTGGTCCATACATGTTCTTTGATATTGCCGATGGTCGTGAGCGTGCTGGAACAAGTGCTGCTGCACAATCACTCTCTAATCA
ATTTGAAGCTGATGCAGCACTTGAAATACTGTCATTTTTAAAGAACAGATATCCAGCAGATTTCTCCTGTAGAAAGATAGGGATCATAACTCCATACAGG
AGTCAACTCTCCTTGCTGCGTTCAAGGTTCACTTCTTTTTTTGGGCCTGAGATCGTTGCTGAGATGGAAATCAATACTGTGGATGGATTTCAAGGTCGGG
AAGTTGACATCTTGGTGTTGTCAACTGTTAGAGCTTCCAACTCCTCAGAATGCTAAAGAACGGAATATGCTCATCTCAGTTCAGAAGCCCTATAGTCTGA
TCTTTCAAAATGTTCATGGTACTACCCATAGTCACCTTAAGCAGCAGAAGGAAAATGAAAAGGCTGATATGACAAACTCGCGGACAGTCAATGCACAACT
CCATAAAGAACATGTGAGACATGCTGACAGTGCTACAGAAAAGATAGGCAAAAGTTTACGTGAGGATCAGGCAAAACAAGCATCACGCTGGGATCAAAAG
ACTCGTAAAACTCGAGACTCCACCTTGAGAAAATTCAGTCAAGAAAATGAAGCGACAACGCANAATGATGATATGAGAGCTACCAAGGGCTCATTGAAAC
AAGATATTGATCAGGATT
page-top