Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whcs10d13
Contig Information
Length 759 bp
Tissue Callus
Clones 1 Clones [Download: CSV  ,  FASTA ]
whcs10d13   
Homology (BLAST) Top Hit unnamed protein product [Tetraodon nigroviridis]
Score 93
Evalue 0.148118
Total Hit Count 37
Registered year 2003
Contig Sequence     [ Download ]
>whcs10d13
CGCACATCGGTCATCCCCATCGAGAAACACACCCCGNTCCCGACTCCACAAATCAGTCTCCGGCGAGATCCCATCGATCTCCGACGTGCGGCGCCGTCTC
CCTCGTCCGGCGGGAGGAAAGGAATCGTTCGCTGGCCCCGCACGCACCCAGTCGTCTTGTATCACGGGCTATTCGTTCTTCTCTCTATCCTGACGAGCAG
ACCATAGCCCGCTGGACGCCGCTGCCACCCCTCGACCTCCTCGCACTGGAGTCGCCGCCCTCCTCCCCTCAGCTTCCCGGACCTCGCGCACCTGCTCCCT
TGCCAAGTACGTCCAGGCGGCCGCCATACTCACCGGCTCCCCCAGCGGCGCCAATCTCAAGAGCCCCTCCAGCTGCTCCGACAGCTCGATTTCGTGCATC
CAGGCTCGATTACTTCAAGAAGGAGGTGGATGACGACGAGGCAGAGCTCCTAGACACGGCCGCCTGTCCCGGGGAGGCCTGCAGCAACGACGGCTTCTGG
TGCACGCGGAGGTCTCTGCGGAGGTGGAAATTTAATCCGACCTCACCTGGGGCTGCTGGCCTCCCCGAGCTCCTACTGCCGGCGGCCTCCTCCCCAAGCC
CCAAGCGCGAACAANATGGAGGTGGTCAAGGGAAGCANTCATGAGCGAGGTGTTTGANGGCTACNANGGCCACTAATGAANTTATCANCACTANGCATGT
CANTTTGGNANGTGGANGCTTTATTTTNATGTANGTTAACATTTNATTTNGGNAANNTC
page-top