Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whcs10a13
Contig Information
Length 723 bp
Tissue Callus
Clones 1 Clones [Download: CSV  ,  FASTA ]
whcs10a13   
Homology (BLAST) Top Hit OSIGBa0137L20.4 [Oryza sativa (indica cultivar-group)] >gi|125548226|gb|EAY94048.1| hypothetical protein OsI_15827 [Oryza sativa Indica Group]
Score 618
Evalue 2.02008e-64
Total Hit Count 320
Registered year 2003
Contig Sequence     [ Download ]
>whcs10a13
GTAAAGCCTTCCGTCATGAACTGANAAAAATGATCCCGCCTCCCTTTCCATATAGTCAACACACATCTGCCTAGCCATATCATAAGTTTCTGGATCACCA
TAAACTTGATCAGCAACTGCTCTGAACAGGCAATTCCCATCTGCTGCCATCTTTCTTATTTCAAACCCTTTCACTCGCCTTAGGTCATGTTCGAACATAT
GCTCCCTTTCCGAATCATCATAGCTANAGGNGTAACAGGCACCTTGCTCATCTGCACTATTGTACCCTTCACAATCAGCAAGNGACCTAGGGGAANAAGG
GCGAGAACCCGAAGCANATGTCCAAGCTGCCACTGGNGGCCAAGCAGCTGGCCTTCTTGAANATCCAATCCGCACACCATTTGAGCTTCCANATCCCATT
CTCCTCAACCCATTATTACCAAATGATGATGGTTTTGGTGGTGGAGCCGGAGGAGGCGGTGGGTGTGATGCTGCTCCAGTTATCTGCGATGGCACAGTGC
CTGACTGCACAGGATTCNCCTGCTCAAACTGATCCGGAAGCTGGAGTCCTGACAGCTCCATCAANAAAGGGGGATCGGTCACATTGGAGTCATCCTTGGG
AGGTTTCTCTCTCTCAAATCCCTCTTCCACATGACTTGAGCTCTCAAACACAGTTTCAACCAGCCTTGAAGGATCATTGCTACTACTTTCGCCACCCTCA
AGTANATGCTCAGTTGTATCACC
page-top