Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_VWD_all.Contig1944
Contig Information
Length 832 bp
Tissue Shoot grown with dessication
Clones 119 Clones [Download: CSV  ,  FASTA ]
whvd10b03    whvd10c16    whvd10d18    whvd10m15    whvd10n03    whvd11b16    whvd11k09    whvd11p10    whvd12a03    whvd12a22    whvd12d03    whvd12f03    whvd1n09    whvd2c15    whvd2g10    whvd2p22    whvd3i21    whvd3l11    whvd4l22    whvd5b08    whvd5e16    whvd5m22    whvd5p10    whvd6d21    whvd7h13    whvd7i14    whvd8a14    whvd8a22    whvd8a24    whvd8g15    whvd8n22    whvd8o20    whvd8o21    whvd8p07    whvd8p15    whvd9h02    whvd9j06    whvd9k17    whvd9n22    whvd9o24    whvd13a21    whvd13a22    whvd13j24    whvd15p08    whvd16e04    whvd16i08    whvd16k22    whvd16o09    whvd17g02    whvd17l19    whvd18p10    whvd19n24    whvd20e20    whvd20g12    whvd20g13    whvd20h14    rwhvd10b03    rwhvd10c16    rwhvd10d18    rwhvd10m15    rwhvd10n03    rwhvd11b16    rwhvd11k09    rwhvd11p10    rwhvd12a03    rwhvd12a22    rwhvd12d03    rwhvd1n09    rwhvd1p03    rwhvd2c15    rwhvd2g10    rwhvd2o12    rwhvd2p22    rwhvd3i12    rwhvd3i21    rwhvd3o23    rwhvd4b10    rwhvd4l22    rwhvd5b08    rwhvd5e16    rwhvd5m22    rwhvd5o03    rwhvd5p10    rwhvd6d21    rwhvd7h13    rwhvd7i14    rwhvd8a14    rwhvd8a22    rwhvd8a24    rwhvd8d15    rwhvd8g15    rwhvd8n22    rwhvd8o20    rwhvd8o21    rwhvd8p07    rwhvd8p15    rwhvd9h02    rwhvd9j06    rwhvd9k17    rwhvd9o24    rwhvd13a21    rwhvd13a22    rwhvd13j24    rwhvd14m24    rwhvd15p08    rwhvd16e04    rwhvd16e15    rwhvd16i08    rwhvd16k22    rwhvd16o09    rwhvd17g02    rwhvd17l19    rwhvd18p10    rwhvd19n24    rwhvd20e20    rwhvd20g12    rwhvd20g13    rwhvd20h14    rwhvd20m20   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein [Secale cereale]
Score 928
Evalue 2.63239e-98
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_VWD_all.Contig1944
TTTTTTTTTTGTTTTCCATTGGTTACCATTAAAACGTATATAGTCGACATATTGTATAATATTATGCGTCCGTGCATATACATAGCCACCGATAGCATTC
ACATACGAGCATGCTTTCTCGAGCCATGTTCGTACATGAACATGGACATACACATATTCTTAGGAACAAATAAGAAAGATAAATGGAGAAGGAAAACCCA
AAGCAATGTCAGAGTTGACAAAACTGCAATGGCACTTTATATATGGCCTGTCGTGAGTGAGCTGTTTAGGCCTTGCCGGACTCCTCGCAGCCCGGTGGCT
TGAAGGCGATGAAGCTGACGCACTGCACCTGACGCATGTTGTCGAATCCGATGATGCGGACATAGGCGTCAGGGTACTCCTTCTTGACCTCCTCCACCTC
GTTGATCACCTGCGTGGCGTCGGTGCATCCGAACATAGGCAGCTTCCACATTGTCCAGTACCGGCCATCGTAGTACCCAGGGGATGCGTTGTGCTCACGG
AAGATGAACCCAACCTTGCTGAACTCGAGGCAAGGCACCCACTTGGAGCGGATCAGGTAGTCGACCTGCTTAAGGAGGGCCTCCGTGCTGAGCGGTGGCA
AGTAGGACAGGGTCTCGAACTTCTTGATGCCCTCGATGGGCCACACCTGCATGCACCTGATCCTTCCACCGTTGCTGACGCTGCCGAGGCTAGCGCCGTT
GGAGCGGCGGCTGACGGGGAGGCCGGCGGTGGACTTGAGCCCCTGGAAAGGAGCGACGGAGGTGGCCGACGAGGCCATCACGGTGGGGGCCATGGCTGTA
CTATGTAGGTATATAGCTTGCTAGGAGGAGGC
page-top