Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_VWD_all.Contig1943
Contig Information
Length 850 bp
Tissue Shoot grown with dessication
Clones 116 Clones [Download: CSV  ,  FASTA ]
whvd10d15    whvd10h24    whvd10o06    whvd10p13    whvd11e02    whvd12d11    whvd12d16    whvd12e17    whvd12f22    whvd12i20    whvd12j08    whvd1n11    whvd1n17    whvd2b01    whvd2p23    whvd3k03    whvd4a07    whvd4g08    whvd4p07    whvd5b02    whvd5l16    whvd6f21    whvd6g03    whvd6l06    whvd6o24    whvd7e07    whvd7e11    whvd8c23    whvd8j24    whvd8p11    whvd9g14    whvd9h01    whvd9i11    whvd9k14    whvd13e12    whvd13e23    whvd13g09    whvd14e02    whvd14l04    whvd14o11    whvd15b08    whvd15g01    whvd15l08    whvd16b10    whvd16h20    whvd17m05    whvd18a19    whvd18c23    whvd18h09    whvd18h10    whvd18j01    whvd18j02    whvd18j14    whvd19a10    whvd19o16    whvd20a14    whvd20f06    whvd20f17    whvd20l23    rwhvd10d15    rwhvd10d16    rwhvd10h24    rwhvd10p13    rwhvd11e02    rwhvd12d11    rwhvd12e17    rwhvd12f22    rwhvd12i20    rwhvd1c18    rwhvd1c20    rwhvd2b01    rwhvd2p23    rwhvd3k03    rwhvd4a07    rwhvd4g08    rwhvd4p07    rwhvd5b02    rwhvd5l16    rwhvd6f21    rwhvd6g03    rwhvd6l06    rwhvd6o24    rwhvd6p12    rwhvd7b11    rwhvd7e07    rwhvd7e11    rwhvd8c23    rwhvd8j24    rwhvd8p11    rwhvd9g14    rwhvd9h01    rwhvd9i11    rwhvd9k14    rwhvd13e12    rwhvd13e23    rwhvd13g09    rwhvd14l04    rwhvd14o11    rwhvd15b08    rwhvd15g01    rwhvd15l08    rwhvd16b10    rwhvd16h20    rwhvd17m05    rwhvd18a19    rwhvd18c23    rwhvd18h09    rwhvd18h10    rwhvd18j01    rwhvd18j14    rwhvd19a10    rwhvd19o16    rwhvd20a14    rwhvd20f06    rwhvd20f17    rwhvd20l23   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit ribulose-1,5-bisphosphate carboxylase/oxygenase small subunit [Triticum aestivum]
Score 876
Evalue 2.91688e-92
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_VWD_all.Contig1943
CCCCGGGCTGCAGGTCCTAGCAAGCTATATACCTACATAGTACAGCCATGGCCCCCACCGCTGATGGCCTCGTCGGGCCACCTCCGGTCGCTCCTTTCCA
GGGGCTCAAGTCCACCGCCGGCCTCCCCGTCAGCCGCCGCTCCAACGGCGCTAGCCTCGGCAGCGTCAGCAACGGTGGAAGGATCAGGTGCATGCAGGTG
TGGCCCATCGAGGGCATCAAGAAGTTCGAGACCCTGTCTTACCTGCCACCGCTCAGCACGGAGGCCCTCCTCAAGCAGGTCGACTACCTGATCCGCTCCA
AGTGGGTGCCTTGCCTCGAGTTCAGCAAGGTTGGGTTCATCTTCCGTGAGCACAACGCATCTCCTGGGTACTACGATGGCCGGTATTGGACAATGTGGAA
GCTGCCTATGTTCGGGTGCACTGACGCCACACAGGTGATCAACGAGGTGGAGGAGGTCAAGAAGGAGTACCCTGACGCGTATGTCCGCATCATCGGATTC
GACAACATGCGTCAGGTGCAGTGCGTCAGCTTCATCGCCTTCAAGCCACCGGGCTGCGAGGAGTCCGGCAAGGCCTAAACAGCTCACTCACGACAGGCCA
TATATAAAGTGCCATTGCAGTTTTGTCAACTCTGACATTGCTTTGGGTTTTCCTTCTCCATTTATCTTTCTTATTTGTTCCTAAGAATATGTGTATGTCC
ATGTTCATGTACCAACATGGCTCGAGAAAGCATGGCTCGTATGTGAATGCTATCGGTGGCTATGTATATGCACGGACGCATAATATTATACAATATGTCA
ACTATATACGTTTTAATGGTAACCAATGGAAAATATCTCCAAAAAAAAAA
page-top