Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_VWD_all.Contig1942
Contig Information
Length 859 bp
Tissue Shoot grown with dessication
Clones 116 Clones [Download: CSV  ,  FASTA ]
whvd10e03    whvd10i21    whvd10o21    whvd11h03    whvd11n11    whvd11n12    whvd12f09    whvd12l20    whvd12p14    whvd1k12    whvd1o11    whvd1p05    whvd2p10    whvd4d16    whvd4i18    whvd4j05    whvd5b12    whvd5d16    whvd5o21    whvd6c04    whvd6h06    whvd6j10    whvd7h08    whvd7h15    whvd7j16    whvd7m16    whvd7o02    whvd8i03    whvd8j10    whvd8p12    whvd9b02    whvd9e24    whvd9f11    whvd13d03    whvd13h10    whvd13h20    whvd14i21    whvd14n11    whvd14o24    whvd14p14    whvd17a10    whvd17c13    whvd17e11    whvd17m23    whvd18a22    whvd18b13    whvd18i01    whvd19j01    whvd19j02    whvd19j13    whvd19p09    whvd19p10    whvd19p18    whvd19p21    whvd20j09    rwhvd10e03    rwhvd10i21    rwhvd10o21    rwhvd11h03    rwhvd11n11    rwhvd11n12    rwhvd12f09    rwhvd12l20    rwhvd12p14    rwhvd1k12    rwhvd1o11    rwhvd1p05    rwhvd2p10    rwhvd4d16    rwhvd4i18    rwhvd4j05    rwhvd5b12    rwhvd5d16    rwhvd5o21    rwhvd6c04    rwhvd6h06    rwhvd6j10    rwhvd6j21    rwhvd7h08    rwhvd7h15    rwhvd7j16    rwhvd7m16    rwhvd7o02    rwhvd8g01    rwhvd8j10    rwhvd8p12    rwhvd9b02    rwhvd9e24    rwhvd9f11    rwhvd9f21    rwhvd9j02    rwhvd9j13    rwhvd13d03    rwhvd13h10    rwhvd13h20    rwhvd14i21    rwhvd14n11    rwhvd14o24    rwhvd14p14    rwhvd16f24    rwhvd17a10    rwhvd17c13    rwhvd17e11    rwhvd17m23    rwhvd18a22    rwhvd18b13    rwhvd18i01    rwhvd18i02    rwhvd18j23    rwhvd19j01    rwhvd19j13    rwhvd19p09    rwhvd19p10    rwhvd19p21    rwhvd20g08    rwhvd20j09   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein [Secale cereale]
Score 923
Evalue 1.06283e-97
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_VWD_all.Contig1942
AAATAAAAGATGTGCGTGCGGTGCCAAAGATGTTTCTCATTATTAATTACCCGAATACATAGTCGACAGATTGTATAAATATATTATGTGCATGTGCATA
TACATAGCCCACCGATTGCATTCACATACGAGCATGCTTTCTCGAGACATGTTGGTACATGAACATGGACATACACATATTCTTAGGAACAAACAAGAAA
GATAAATGGAGAAGGAAAACCCAAAGCAATGTCAGAGTTGACAAAACCGCAATGGCACTTTATATGTGGCCCGTGGTGAGTGAGCTGTTTAGGCCTTGCC
GGACTCCTCGCAGCCCGGTGGCTTGAAGGCGATGAAGCTGACGCACTGCACCTGGCGCATGTTGTCGAATCCGATGATGCGGACGTACGCGTCAGGGTAC
TCCTTCTTGACCTCTTCCACCTCGTTGATCACCTGTGTGGCGTCGGTGCACCCGAACATAGGCAGCTTCCACATTGTCCAGTACCGGCCATCGTAGTACC
CAGGGGATGCGTTGTGCTCACGGAAGATGAACCCAACCTTGCTGAACTCGAGGCAAGGCACCCATTTGGAGCGGATCAGGTAGTCGACCTGCTTGAGGAG
GGCCTCCGTGCTGAGCGGTGGCAGGTAGGACAGGGTCTCGAACTTCTTGATGCCCTCGATGGGCCACACCTGCATGCACCTGATCCTTCCACCGTTGCTG
ACGCTGCCGAGGCTAGCGCCGTTGGAGCGGCGGCTGACGGGGAGGCCGGCGGTGGACTTGAGCCCCTGGAAAGGAGCGACGGAGGTGGCCGACGAGGCCA
TCACGGTGGGGGCCCATGGCTGTGCCTATGTAGGTATATAGCTTGCTAGGAGGAGGCAC
page-top