Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_VWD_all.Contig1938
Contig Information
Length 1518 bp
Tissue Shoot grown with dessication
Clones 92 Clones [Download: CSV  ,  FASTA ]
whvd10g21    whvd10g22    whvd11g01    whvd12c15    whvd12m24    whvd2c09    whvd2g23    whvd2l21    whvd2p17    whvd3e07    whvd4d14    whvd4k16    whvd5i13    whvd6j17    whvd7a06    whvd7c12    whvd7e02    whvd7m17    whvd7m18    whvd8f04    whvd9l16    whvd9o15    whvd13a24    whvd13c24    whvd13d11    whvd13j03    whvd13j04    whvd13p02    whvd13p13    whvd14l06    whvd15e18    whvd15f13    whvd15j24    whvd16f16    whvd16f17    whvd16h21    whvd16i11    whvd17d24    whvd18a04    whvd18a15    whvd18c11    whvd19i21    whvd19p23    whvd20c22    rwhvd10c17    rwhvd10g21    rwhvd10g22    rwhvd11g01    rwhvd12c15    rwhvd12c16    rwhvd12e01    rwhvd12m24    rwhvd2c09    rwhvd2g23    rwhvd2l21    rwhvd2p17    rwhvd3p18    rwhvd4d14    rwhvd4k16    rwhvd5i13    rwhvd5n23    rwhvd6j17    rwhvd7c12    rwhvd7e02    rwhvd7m17    rwhvd7m18    rwhvd7o10    rwhvd7p04    rwhvd8f04    rwhvd9l16    rwhvd9o15    rwhvd13a24    rwhvd13c24    rwhvd13d11    rwhvd13p02    rwhvd13p13    rwhvd14l06    rwhvd15e18    rwhvd15f13    rwhvd15j24    rwhvd16f16    rwhvd16f17    rwhvd16h21    rwhvd16i11    rwhvd17d24    rwhvd17h02    rwhvd18a15    rwhvd18c11    rwhvd18g18    rwhvd18h05    rwhvd19i21    rwhvd20c22   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os07g0529600 [Oryza sativa (japonica cultivar-group)] >gi|32352138|dbj|BAC78562.1| thiamine biosynthetic enzyme [Oryza sativa Japonica Group] >gi|113611377|dbj|BAF21755.1| Os07g0529600 [Oryza sativa (japonica cultivar-group)] >gi|215712225|dbj|BAG94352.1| unnamed protein product [Oryza sativa Japonica Group]
Score 690
Evalue 2.57414e-70
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_VWD_all.Contig1938
TTTTTTTTTTAACCGAATAGAGGTAGATTAATTTATAATCCATATATGATAAGCGTACATCGTACAAAGTACAACAAACTCCCGCTGTCTGCTCAAAGGG
AGTGAACGAACAATCAAACGCTGATACAAAATAGATACAACAGTGGCCAGCTATGCAAAGCTGGCTCGATGTACGTACTCCTATCTCTCACATGGAGATC
ATATCAGAGCATTTATTCATGTATATGTATATATGTGTGTGTGAGACCTCAACGTACTCAGCATCAATCGCTGGAACTATAATCGGCGATGATGGCGGCC
AGAAATCGATCAGTGGATCTTAGAGCAGTCCACGGATGCGCTGATCGTGTAGGGGACGCTGACGCCGCACTTGGAGGGAATGCCTGCGGCCTTGTTGGGG
TTGAGCCCTCCGGCAACACTCTTGAGGCACCTGCATGTAGCTTGCTTGTCGGCGGTGCTCCGCGCTAAGCCGGCCAATTTCCTGACGCCGCTGCAGCAGG
CCCCAGACGGGCTGGTCCCGCTGCCCTTCGCATAGGCGACGCAGGGGGTCAAGGCAGAGCTCACCTGGCCGCAGCTGATGGCCGCGTCGGAGGCTGCGAG
GATCATTGCCGCCACCAGGGCGACCAGCACGAGTTTAGTAGCTGCAGTGCGAGCCATCTCGACCGAGTTAGCTGTAGTTGTGGACCTTGTGGTGGTGGGC
TAGCTCACGGAGAGAGGGTGGGATAGCTAGCGGCACGAGGCCTCGTGCCGAATTCGGCACGAGGTAGAACTCAACCTTTTTATTCCCTCCTCTTGTTCCA
TAAGGATTCATCATCCATGGAGCTGCCGTGAGGCAGAGCAGAGCAGAGCACATGGCGGGCAGGTGGCATGAACAAAATACGCTAACACAAGAAAACTAAA
GATAAACATCGGAATTAAACACGAGTCTGACAAATCACAAAGACAAGACCTCGTCCCTAAGCATCCTCTGTTTCACCGAACCATCTTATTGATTTTTCGC
CCCGAAACACCAGCGTACGTACGCCTTGGTGTCCGTGGTTCATTGCTTTGCTTAGGCGTCCACGATGTCGCCGTTGTTGGTCGCCGCCAGGATCATCTCC
GGGTGCAGCGCCGGGGTCACGTTCTTGAGCGTCCCGTCGATGCCGTTCGGCCGGCCGAGGGCCTTGAGCGCCAGGTGCGCCGCCTTCTGGCCGGAGATCA
TCATGGCGCCGAAGGTCGGGCCCATTCTCGGGGCGCCGTCGATCTCGGCGACCTCCATGCCGGTGACAATCATGCCGGGGACCACCTCCCGGGTGAGGCG
CACGATGGCATCCTCGGCCGTGTTCATGTCGAGCGCCTTCATCCCGGGCACCGCCTGGATCATGCCGATGTCCTGGAGCCGCTTGACCCCGGTGGCGCCG
AAGGGCCCGTCGTGGCCGCAAGAGCTCACCACGACCTTGGCCTCCATGACGTTGGGGTCCATGCAGGACTGTGTGTCGTGGTTCATGGAGACGAGCGCCC
AGTTGGTGACGACGCCGG
page-top