Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_VWD_all.Contig1937
Contig Information
Length 2169 bp
Tissue Shoot grown with dessication
Clones 90 Clones [Download: CSV  ,  FASTA ]
whvd10b16    whvd10c20    whvd10e05    whvd10i02    whvd11j02    whvd11j16    whvd11m10    whvd11m21    whvd12p15    whvd1b20    whvd1i04    whvd2e10    whvd2l02    whvd2l13    whvd3c17    whvd4j10    whvd4o03    whvd4o07    whvd5f15    whvd6a05    whvd6a13    whvd6h03    whvd7e04    whvd8g18    whvd9l22    whvd13c05    whvd13h22    whvd13j21    whvd14h20    whvd15e07    whvd15k19    whvd15p10    whvd16f03    whvd16f15    whvd16n16    whvd16o11    whvd18b02    whvd18e02    whvd19e05    whvd19h07    whvd19k23    whvd19k24    whvd20i04    rwhvd10b16    rwhvd10c20    rwhvd10e05    rwhvd10i02    rwhvd11j02    rwhvd11j16    rwhvd11m10    rwhvd11m21    rwhvd12p15    rwhvd1k02    rwhvd2e10    rwhvd2l02    rwhvd2l13    rwhvd3c17    rwhvd3j09    rwhvd4j10    rwhvd4o03    rwhvd4o07    rwhvd5f09    rwhvd5f15    rwhvd6a05    rwhvd6a13    rwhvd6a14    rwhvd6f08    rwhvd6h03    rwhvd7e04    rwhvd8g18    rwhvd9l22    rwhvd13c05    rwhvd13h22    rwhvd13j21    rwhvd14h20    rwhvd15e07    rwhvd15k19    rwhvd15p10    rwhvd16f03    rwhvd16f15    rwhvd16g02    rwhvd16i06    rwhvd16k12    rwhvd16n16    rwhvd16o11    rwhvd18b02    rwhvd18e02    rwhvd19e05    rwhvd19h07    rwhvd20i04   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit [Anemanthele lessoniana]
Score 1287
Evalue 0
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_VWD_all.Contig1937
TTTTTTTTTTATTTCGTTTCTTTTTTATTTATACCTTCTCTTCTTTATCTTTAGTTTTATCTACTTATCAATAGTATCTACCGGCTCGAACTCGAATTTG
ATCGCCTTCCATACTTCACAAGCTGCGGCTAGTTCAGGACTCCATTTGCAAGCTGCTCGGATAATTTCATTACCTTCGCGAGCAAGATCGCGCCCTTCGT
TACGAGCTTGTACACAGGCTTCTAAAGCCACTCGATTAGCTGCTGCACCAGGTGCATTTCCCCAAGGATGTCCTAAAGTTCCTCCACCAAATTGTAATAC
AGAATCGTCCCCAAAGATTTCGGTCAGAGCTGGCATATGCCAAACATGAATACCACCTGAAGCTACCGGTATAACACCTGGCATGGATACCCAGTCCTGA
GTGAAAAAGATACCGCGAGCACGATCTTTTTCAATAAAATCATCGCGCAATAAATCAACAAAACCTAAAGTCATTTCGCGTTCCCCTTCTAACTTACCTA
CTACTGTACCGGAGTGGATATGATCTCCCCCAGACATACGCAATGCTTTAGCTAATACACGGAAATGCATACCATGATTTTTCTGTCTATCAATAACTGC
ATGCATTGCACGGTGAATGTGAAGAAGTAGGCCATTGTCGCGGCAATAATGAGCCAAAGTAGTATTTGCGGTGAATCCCCCAGTTAAGTAGTCATGCATT
ACAATAGGAACCCCTAATTCTCTTGCAAATACAGCTCTCTTAATCATTTCTTCACATGTACCCCGCAGTCGCATTCAAGTAATGCCCCCTTGATTTCACC
GGTTTCCGGCCTGTGATTTATAAATAGCTTCGGCACAAAAGACAAAACGGTCTCTCCAGCGCATAAATGGTTGTGAGTTTACGTTTTTCATCATCTTTGG
TAAAATCAAGTCCACCACGTAGACACTCATAACACGCTCTACCATAATTTTTTGCGGATAATCCCAATTTTGGTTTAATAGTACATCCCAATAAAGGACG
ACCATACTTGTTCAACTTATCTCTTTCAACTTGGATACCATGAGGCGGGCCTTGGAAAGTTTTTGAATAAGTAGGGGGAATTCGTAGATCCTCCAAACGT
AGAGCACGTAGGGCTTTGAAACCAAATACGTTACCTACAATGGAAGTAAACATGTTAGTAACGGAACCCTCTTCAAATAGGTCTAATGGATAAGCTACAT
AACAGATCCATTGGCTGTCTTCCCCAGCAACAGGCTCGATGTGATAGCATCGTCCTTTGTAACGATCAAGACTGGTAAGTCCATCAGTCCAAACAGTTGT
CCATGTACCAGTAGAAGATTCGGCAGCTACTGCAGCCCCTGCTTCTTCGGGCGGAACCCCAGGCTGAGGACTTACTCGGAATGCTGCCAAGATATCAGTA
TCCTTAGTTTCATACTCTGGGGTGTAGTAAGTCAATTTATAATCTTTAACACCAGCTTTAAATCCAACACCTGCTTTAGTTTCTGTTTGTGGTGACATAA
GTCCCTCCCTATAACTCTTGAATTAAGAATTCTCCGGTACCATGCAATGCTGGTGCTGTTAATAATATTTCTAGAGCTCCTTGCCCAAGTTCAGATGTGC
AAGATGATAATGAGTACCCCTTTGAAGATGGTGATCTTGATGATGGACTTGATCCTGCAATGCAGGAAGAGCTTGATAGGGAAGTTGAAGATTTCGCTAG
GAGGCTGAATTCTGTTTGGCCTGAAAGAATGCATTTGGGTCAAGAAAGAAGAATTGAGTCGCAGCTGATTGGTGGTAATGGTTCTCNGCAGAGATTTTCT
GGGTTCAATCACAGGTGAATGCCATGCGGCAGGATGAGCAAGCTGAAGCCTAGGAAATTTGTGCACATACAGCTTCGAAGAGAGGTAGAGACCGAAGTGA
GCAGCTGCTGCCGAAAAGGCCTTGAANCTCGGAACCGAGCTTGCAGACAATGTGCATCTGTTTCCCTTTGCCATTTTTGGCGCAGGGTCCGGCTCGTCAA
AGTTGGGATGAAGCATAGCAAGGTTTTAGATAGATCAAGGGGGGAAATTTTCCGGTCCGGTCGTGTTATTTCTTGGATAAGCGTNTGTTCANTCTGGGTC
GACTCTGTTTTTTCCGTCGTCGCAATTTTCCCTGGATCAGAGCAGAGTGTGCANTCTGTAAGAAATGAT
page-top