Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_VWD_all.Contig1935
Contig Information
Length 837 bp
Tissue Shoot grown with dessication
Clones 77 Clones [Download: CSV  ,  FASTA ]
whvd10d03    whvd10j07    whvd10k20    whvd10p03    whvd10p04    whvd11o11    whvd11p01    whvd12j07    whvd12m05    whvd1l10    whvd2e07    whvd2h13    whvd2i21    whvd3f12    whvd3i10    whvd5b19    whvd5k19    whvd6d10    whvd6i20    whvd6n09    whvd6o07    whvd7g23    whvd8d05    whvd8d06    whvd8h06    whvd9b20    whvd13a08    whvd13b06    whvd13c07    whvd13c19    whvd14a15    whvd14a16    whvd16c22    whvd18a06    whvd18a17    whvd18d14    whvd18n01    whvd19c01    whvd19k12    whvd20g20    rwhvd10d03    rwhvd10j07    rwhvd10k20    rwhvd10p03    rwhvd10p04    rwhvd11o11    rwhvd11p01    rwhvd12l04    rwhvd12m05    rwhvd1b15    rwhvd2e07    rwhvd2h13    rwhvd3f12    rwhvd3i10    rwhvd5b19    rwhvd5k19    rwhvd6d10    rwhvd6i20    rwhvd6n09    rwhvd6o07    rwhvd7g23    rwhvd8d05    rwhvd8h06    rwhvd9b20    rwhvd13a08    rwhvd13c07    rwhvd13c19    rwhvd14a15    rwhvd14a16    rwhvd16c22    rwhvd18a06    rwhvd18a17    rwhvd18d14    rwhvd18n01    rwhvd19c01    rwhvd19k12    rwhvd20g20   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein [Secale cereale]
Score 928
Evalue 2.65067e-98
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_VWD_all.Contig1935
TCGTGCCGCCTCCTCCTAGCAAGCTATATACCTACATAGTACAGCCATGGCCCCCACCGTGATGGCCTCGTCGGCCACCTCCGTCGCTCCTTTCCAGGGG
CTCAAGTCCACCGCCGGCCTCCCCGTCAGCCGCCGCTCCAACGGCGCTAGCCTCGGCAGCGTCAGCAACGGTGGAAGGATCAGGTGCATGCAGGTGTGGC
CCATCGAGGGCATCAAGAAGTTCGAGACCCTGTCTTACCTGCCACCGCTCAGCACGGAGGCCCTCCTCAAGCAGGTGGACTACCTGATCCGCTCCAAGTG
GGTGCCTTGCCTTGAGTTCAGCAAGGTCGGGTTCATCTTCCGTGAGCACAATGCGTCTCCCGGGTACTACGACGGCCGCTACTGGACAATGTGGAAGCTG
CCTATGTTCGGGTGCACCGACGCCACACAGGTGATCAACGAGGTGGAGGAGGTCAAGAAGGAGTACCCTGACGCGTACGTCCGCATCATCGGATTCGACA
ACATGCGCCAGGTGCAGTGCGTCAGCTTCATTGCCTTCAAGCCACCGGGCTGCGAGGAGTCCGGCAAGGCCTAAACAGCTCACTCACCACGGGCCACATA
TAAAGTGCCATTGCAGTTTTGTCAACTCTGACATTGCTTTGGGTTTTCCTTCTCCATTTGTCTTTCTTACTTGTTCCTAAGAATATGTGTATGTCCATGT
TCATGTAACAACATGGCTCGAGAAAGCGTGCTCGTATGTGAATGCAATCGGTGGGCTATGTATATGCACATGCACATAATATATTATACAATCTGTCGAC
TAAAAAAAAGATGCCCACCCCATGGGTGTCCTTGCCA
page-top