Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_VWD_all.Contig1927
Contig Information
Length 2766 bp
Tissue Shoot grown with dessication
Clones 41 Clones [Download: CSV  ,  FASTA ]
whvd10a11    whvd10m14    whvd10m20    whvd11a04    whvd11l05    whvd1h03    whvd1o18    whvd2i16    whvd2k23    whvd3k24    whvd4a16    whvd6p13    whvd8m06    whvd9j07    whvd9p10    whvd13e04    whvd13f22    whvd13k18    whvd13p06    whvd14f03    whvd15c05    rwhvd10a11    rwhvd10m14    rwhvd10m20    rwhvd11a04    rwhvd11l05    rwhvd1g18    rwhvd1h03    rwhvd2i16    rwhvd2k23    rwhvd4a16    rwhvd6p13    rwhvd9j07    rwhvd9j24    rwhvd9p10    rwhvd13e04    rwhvd13f22    rwhvd13k18    rwhvd13p06    rwhvd14f03    rwhvd15c05   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit methionine synthase 1 enzyme [Hordeum vulgare subsp. vulgare]
Score 3614
Evalue 0
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_VWD_all.Contig1927
CGTCTGCCTCATGTCGCGCACAGCAAACCGGCCCAGGGGAGGGTACTGGGCAAAGGTTTCCACCACCATGGGCTTGGTGGGGATCATCTTGACGAACCCG
GCATCACCGTTCTTCAGGAACTTGGGCGCCGCCTCAATCTGCCTCTCCTCCTCCCCGTTGCTCGCCGCCGTCCCTCTCCGCCTCCGGCGCACCCAGGAAA
GATGGCGTCCCACATTGTCGGATACCCGCGCATGGGCCCCAAGAGGGAGCTCAAGTTTGCCCTGGAGTCTTTCTGGGATGGCAAGAGCAGCGCCGAGGAT
TTGGAGAAGGTTGCCACCGACCTCAGGGCCAGCATCTGGAAGCAGATGGCTGATGCTGGGATCAAGTACATCCCCAGCAACACCTTCTCCTACTATGATC
AGGTTCTTGACACCACCGCCATGCTCGGTGCCGTCCCAGACCGTTACTCATGGACCGGTGGGGAGATCAATTTGAGCACCTACTTCTCGATGGCTAGGGG
TAACGCCACCGTCCCTGCTATGGAGATGACCAAGTGGTTTGACACCAACTACCACTTCATCGTCCCTGAATTGGCTCCTAGCACCAAGTTCTCCTACTCT
TCTCACAAGGCTATCAATGAGTACAAGGAGGCTAAGGCGCTTGGCGTTGATACCGTCCCCGTACTTGTCGGACCAGTCTCATACTTGTTACTCTCAAAGG
CCGCCAAGGGCGTAGAGAAATCATTCTCTCCCCTTTCCCTTCTTAGCAGCATCCTTCCCGTCTACAAGGAGGTTATTGCTGAGTTGAAGGCAGCTGGCGC
TTCATGGATTCAGTTTGATGAGCCCACCCTTGTTAAGGACCTTGAATCCCACCAATTGTCTGCATTCTCTGCAGCTTACGCAGAACTTGAGTCCGCACTT
TCTGGATTGAACGTTCTTGTTGAGACCTACTTCGCTGACGTTCCCGCAGACTCGTACAAGACTCTTACATCATTGAGCAGTGTAACTGCTTATGGTTTTG
ACCTTGAACGTGGAACCAAGACTCTTGAGCTTGTCAAGAGTGGTTTCCCTGCTGGAAAGTACCTCTTTGCTGGTGTCGTAGATGGACGCAACATTTGGGC
TGATGACCTTGCTGCATCTCTCGCCACTCTTCAGTCTCTCGAGGCTGTTGTTGGGAAGGACAAGCTTGTCGTATCGACTTCGTGCTCACTCATGCACACT
GCTGTGGACCTTGTAAATGAGACCAAGCTTGATGATGAGATTAAGTCATGGCTCGCATTTGCCGCCCAAAAGGTCGTTGAGGTGAACGCCCTTGCCAAGG
CATTGGCTGGTCAAAAGGATGAGGCTTACTTCGCAGCAAATGCTGCTGCTCTGGCCTCAAGAAGGTCGTCACCACGTGTCACAAATGAGGAGGTCCAGAA
GGCTGCTACTGCTCTCAAGGGCTCTGATCACCGCCGTGCTACCACCGTTAGCGCTAGGTTGGATGCGCAGCAGAAGAAGCTCAACCTTCCGGTCCTTCCC
ACGACCACCATTGGATCATTCCCACAGACCGTGGAGCTCAGGAGAGTTCGCCGTGAGTACAAGGCAAAGAAGATCTCTGAGGAGGAGTACACCAACGCCA
TCAAGGAGGAAATTAGCAAGGTTGTTAAGATCCAAGAAGAGCTTGACATTGATGTGCTTGTGCACGGAGAGCCAGAGAGGAACGATATGGTTGAGTACTT
CGGTGAGCAGCTCTCTGGTTTCACATTCACTGCCAATGGCTGGGTGCAATCTTATGGATCCAGGTGCGTCAAGCCACCGATTATCTATGGTGACGTGAGC
CGCCCCAACCCCATGACTGTGTTCTGGTCCAAGATGGCACAGAGCATGACTGCTCGCCCAATGAAGGGAATGTTGACAGGCCCTGTCACAATCCTTAACT
GGTCTTTTGTCAGAAATGACCAACCGAGGTTTGAGACTTGCTACCAGATTGCTCTTGCAATCAAGAAGGAGGTTGAGGATCTTGAGGCAGGCGGTATTCA
GGTCATCCAAATTGACGAGGCTGCTTTGAGAGAGGGTCTGCCACTCCGCAAGTCTGAGCACGCTTTCTACTTGGACTGGGCCGTGCACTCCTTCAGGATC
ACCAACTGCGGTGTCCAGGACACCACCCAGATCCACACCCACATGTGCTACTCCAACTTCAACGACATCATCCAGTCCATCATCAACATGGACGCTGATG
TGATCACCATTGAGAACTCGCGGTCTGACGAGAAGCTTCTCTCCGTCTTCCGCGAGGGTGTGGTGTACGGTGCAGGCATTGGCCCGGGTGTGTACGACAT
CCACTCCCCCAGGATCCCGTCCAAGGAGGAGATTGCCGACCGTGTCAACAAGATGCTCGCGGTGCTCGACACCAACATCCTGTGGGTGAACCCTGACTGC
GGTCTCAAGACCCGCAAGTACGCCGAGGTCAAGCCTGCGCTCACCAACATGGTTGAGGCCGCCAAGCAGATCCGCGCCGAGCTCGCCAAGGCGCAGTAAG
CCGTGCTTGTATAGCAGCTCCCCACTTTTAATTGCAAGGAGGATGTCACCACCATAGCCGTGTTTACTTTTGAATAATCTGGGTCTCGTATCCACTTGTT
GGTTAGGCTAGTTTGTTTCTCGGTGCGGCGCGATGTGCTCATCCCTTGATTTGGTGGTTTTTGAGGCGGTTGTCGGTGTGTATTGTAAACTGAGTGGCGA
ATTGTTCATCTAAGTCTGAGTTTGTTACGTTATGTTTCAAATTACAAAATTTCTCCAAAAAAAAAA
page-top